| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACGCGGUUCGCCGCAGGAGCCUCGAAGGCGCGGCGCCGGCGAGCCCUU… | 4284 nt | 0.5292 |
This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
A systematic review of postmortem human brain studies found that the TJP2 mRNA, a tight junction protein, exhibited decreased transcription in the anterior cingulate cortex of individuals who died by suicide compared to controls [Yamamoto et al. DOI:10.3390/Ijms25115750].