Basic Information

Symbol
TJP2
RNA class
mRNA
Alias
Tight Junction Protein 2 X104 ZO2 Friedreich Ataxia Region Gene X104 (Tight Junction Protein ZO-2) Zonula Occludens Protein 2 Zona Occludens 2 DFNA51 ZO-2 Deafness, Autosomal Dominant 51 Tight Junction Protein ZO-2 Zona Occludens Protein 2 C9DUPq21.11 DUP9q21.11 FHCA1 PFIC4
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_004817.4
Sequence length
4503.0 nt
GC content
0.5150

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1569.10 kcal/mol
Thermodynamic ensemble
Free energy: -1644.40 kcal/mol
Frequency: 0.0000
Diversity: 1154.63
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((.((((((.((..(((((....)).)))...)).))).)))..))....(((((((.((..((((((.((....(((((...((((........(((((.(.(.(((((((...))))))).)))))))((((((((((((.((...((((.(((...))).)))).)).)))))).(((.((((....))))..)))..((....(((((((((......)))))))))....))((((....(((((..........)))))....))))...((((((...........))))))))))))(((((((((((.(((((((((((((...............((((((.(((((((((((.(((((((((.(((((.....))))).......(((((((.((((.......((.....((((((((((.((((.((((((.(((((((((...))).)).)))).(((((((((..(((((((.((((...))))..))..)))))))))))))).........)))))).)))).)))......)))))))...)).....))))..)))))))..))))))))))).((((....))))((.((((.((((.......)))))))))).....(.(((((((...(((..((((..((....((((((((((((.(((((((((.((((.(..(.((((((((.(((......((((..(......)..))))....))))))).)))).)..).)))))))).))))).))))))....))))))....))..))))..)))...))).)))).)..))))))))).)))))))))).))))))))).)))))))...)))).........((((((((...(((.(.....).)))...))))))))))))...)))))..(((((...))))).))))))))..)).)).)))))....((((((((((.(((((........)))))....))))).(((((((.....)))))))....((...))..(((((((...(((.((((......)))))))..)))))))...(((((((((((....))))).((((((....((((.((((.((((((((((((((((..((((((....((.......))....)))))).)))))))..(((((((((.(((((.(((((.(...((..((.(((((((((((((((.(((((((((.(((((..((((((.(((((...........(((((...)))))..((((((.((((((.....)))))).......))))))..((..(((.(((((((.((((((.((.((((((((....))))...))))..)).))))))..).)))))).))).)).((((((..(((((.(((.(((((..(......)..)))))....((((((...)))))).(((((((.(((((((((.(((((((.(.((((..((((((((((...(((((..(((.((((........(((((.(.....).)))))........((.(((((..((((((..(((((((...........)))))))................(((((...))))))))))).....))).).).)).))))..))).))))))))).))))))..))))).))))))).))).))).)))...))))))).)))...))))).....))))))...(((((...((((.(((((...(((....))).((((((((.(((...((.((((.......)))).))...))).)..)))))))....((.((((((((...)))))))).))....(((((((((((((........)))))..)))))..)))...((((.(((.((((((((..((((...))))..))).))))).))).)))).))))).)))))))))....)))))((((((((((.((((.......))))...(.(((((.((((((....)))))).))))).).....((((..(((((.......)))))..)))).......(((...)))..((...((((((((((((....(.(((((.(......).))))).)(((((......))))).)))))).))))))...))((.((((........)))).)).........))))))))))....))))))))))).)))))))))......(((((..((((((((....(((......)))(((((((..((((((.(((((((((((.((((((((.((((...)))).)))).......))))))))))..)))..)).)))))).............)))))))......((((((((((((((..(((((((.(((.((((((.....)))).))........(((.((((((.(..(((.((.....((((......))))...)))))..))))))).)))..)))))))))))))..((((.(((..........((((((((((......(((......))).((.(((...((......))...)))))......(((((...((((....(((((..(((((..((((((((((...(((....))).)))))).))))...............(((((........))))).))))).(((.((((....)).)).))).......((((.(.((((((((((((((.........................)).)))))...))))))).).)))).......((((...))))((((...)))).(((((..(((((.(((((((.(((.((....)).)))...(((((.(((.....))).))))).......((((.((..((...(((((((((.(.(((((.....))))).).))))))))).))..)).))))...............((....))......((((.....)))).)))))))..)))))...)))))))))))))).)))))..(((((((..((((.....(((((.(((((((((...)))...............(((((((((...((((((...................))))))......(((((.(((((((((...........(((........)))..(((..(((((((((((((.......)))((.(((((((..(((((..(((((.((.(((...(((((..((((((((......)))))))))))))))).))..((.((((((......))))))))..)))))(((((.(...((.....(((((....)))))....))..).)))))..............((((((((((((.((.......((((.........))))......)).))))).......(((.(((........))))))...(((((...)))))..((....))....))))))))))))....((((........))))..(((.((.....)).)))..))))))).))....((((....)))).))))))))))..)))))))))))).).)))).............(((((...)))))..((((((((....))))...))))......((.(((((....)))))))((((.(((..(((((((((((.........))))....)).))))).))))))).))))))))).(((((.((((.(((((((....)))))))...(.((((((.....((((((.(((.....))))))))))))))).)...))))..)))))..)))))))))))))))..)))))))..)))))))).))........))).))))..((((....))))..)))))))))))...(((((((.((((((.(((.......))).))))))((((.........)))).....)))))))..........))))).)))..)))))(((...)))((((...))))...(((((((((((...................(((((((((((...(((((((((((((((...((((..(((.(((.((((((...)))))).)))...)))..))))....))).)))))))..)))))...))))).))))))......)))))))))))(((((........)))))..)))))))))))))))))..))).)))))..)))))..)))))))))))))))........(((......)))((((((..................))))))..((((.(((((........))))).))))...))))))).)))).......))))))(((((...((((((((((((......)))).)))))).)).)))))..))))))....(((.(((((((.....(..((((((......))))))..)))))))))))..)))))......
Thermodynamic Ensemble Prediction
.,.(({(({{,{.,|}}|||{|.,,,||{||,{{.||,|||{||,..,|,{{{(,((((((((({(((((({((,..{||{(({(,,,,|}||,....{{{||.|,{.(((((((...))))))).}}}}|||{(({(((({,,{,{|||||||{||||,,,}},.))),.,,,}||,|,.(((.((((....))))..))}.,,,....(((((((((......)))))))))}}}}),)}}))}.,,,,.,.,...}}}}.}}}||...,|||{,...,|}|..,,,}},.,}))),}|}})))),(((((((((((.(((((((((((((,,......,,.....((((((.(((((((((((.(((((((((.(((((.....))))).....,.(((((((.((((.......,(,(,,,{.{||((((({((((,(((,...(((((((((...})).)).)))).(((((((({..(((((((.((((...))))..))..)))))}))))))))...||,.,.|,}))),)))).,.)}))),,,,}}}}}.},)).....))))..)))))))..))))))))))).({((,,,.||||((.((((.((((.......))))))))))....,(,({(((((..,(((,,{(((..{{....|||(({((((((.(((((((((.((((.(..(.((((((((.(((......((((.,(......)..))))....))))))).)))).)..).)))))))).))))).)))))).,,.))))))..,,)),.))))..))}},,)}),)))}.}..))))))))).)))))))))).))))))))).))))))),..,)))......,,.{((((({{...|||,|..,,.).))),,,)))))))),.,}.}})))|||||,(((((((((((.(((|(.||{||}.||..{||,.....|||.{{{{{.(((((.......,)))))}}}.)}))).,.)))))))))))|||.,......}}).,,..(((((((...(((.((((......)))))))..)))))))...(((((((((((....))))).{(((((....((((.((({,((((((((((((((((..((((((.,..({.......)}....)))))).)))))))..(((((((((.(((((.(((((.,..,((,.((.((((((((((((((((((((((..(((((((((((,(((((((((.....,,{{{{(((((,..,}}}},}||||{{.((((((.....)))))),.{{{{{({(({...{{..(((.(((((((.((((((.((.(({(((((....)))),.,})},..)).))))))..}.)))))).))).))...,,,,...(((((..((((((((({,((((.,...((((.,,.((((((...)))))).|((((((.(((((((((.(((((((.(.((((..((((((((((...(((((..(((.((({........(((((,,.....).)))))........{{.(((((..,,,{{{{,(((((((..........,))))))).......,{{.{{{..(((({...}))))))),)),....))).}.}.}).})))..))).))))))))).))))))..))))).))))))).))).))).)))...))))))}.((((((((.(((((((.((((((,,(((,,...,,...))))))))))...,,|...((((((({.(((...((.((((.......)))).))...))).}..))))))).....,}||,,(((({{{{|,,,,,.(({..(((.(((((((((((.,......)))))..)))))).((((((((((.{{{,{{{{{,....|}|({(((((.({,{(((.(,,{....))))))},,{{{{{{(((({.,,.,,)))|||||||||.}|}|}}}...{...,|,....(((((.((((((....)))))}.))))).{{{{({((({..,{((({{.,...}}}}}..))})},,,..,,((.{{((({,.....{{{{{{{{{{{{....{.(((((.(......}.))))).|({(((,.,..,|||||.}}}}}}.}}})))|,{{((((((.((((((({{,({(({{,,...,|||||..||||||{{{((({,,{,,{,,..}|}}|},..,||||||||{,....,.|||,,,|||||,,,,}}|}|||{{,,..((((((.{,||||||{{{.((((((((.((({...}))).)))).......))))}})))),.})),,}}|||||||.....,.......))))))}..{{{,,||,|||}|{.{{,..(((((((.(((,((((((.....)))).},,,,.....(((.((((((.{..(((.((.....((((......))))...)))))..})))))).)))..))))))))))})),}}.,,,}}.})))))))}.)))))))}||...,,.{{(|||...|||.||.{{{...((,,....}}...}||}|,,....|||,{{|{,.,,..}}}}},.,{((,,...{||||,,(((,,.(((....))).))))),.}|||.........,,....,{{{{...,,,..)))))}))))},|}}}..||||}.,..|}|}||.}}.}}.{(((,(.(((((((((((((({,...,,,...,,,..{{{..,,..|,,|}|||...||}||||.,,|||}........||,.,||||||||.{{,{{(({(((((..(((((.(((((((.(((.((....)).)))...(((((.(((.....))).))))).,..,{.((((({({,(({|{({(,,,,{|.|,||||{}},}})}}}}||.||||||||}.||.,}},,.}}.|,,}},}.||....((....)}.,},,.((((.....)))).)))))))..)))))...)))))...,,.}}},)}}.,..)}},))))})))}}}.})}..,})))}}|,}}}},.)))}..............,{,{{..,,....|,)))))}}..,}},,.,},.....,,}}}..))))))))))(((((((((...........{((........))}..(((..((((((((((,{|,,.,}..}}}|{.{{{{{(({.(((({..{{{{,.|{.(({..((((((,,((((((({...,,,}))))})))))))).)})}..{(.((((((......))))))}}..}},||(((((.(...,(,....{{{{{,...}}}}}.....,..),)))))...|.......,..((((((({{(((.((,.,{,..(({(,,,......}}||......)),)))))...,,,.|||.{||,,......,,,}},...(((((...)))))..((....))....)))))))}))})})),{{||........||||{{({{.{,{,,..,,,)),..,}})))).}),,.,((((....)))),))))))))))..)))))))))))){{,....,,,)))..))),.)))))))}}(((.((((((((((....))))...|||,.....,{{.(((((.,..}||}}}}}.,,.,}}.{(((.....)))).)))))).))),)))))))....))))))))..,{|{|{...,,....,}}}}.(((((((....)))))))))))....)))))))))))))).))))}..,((((.......}))).,,...,|||,..,))},)))))))))).))))),))}}},.)))).)))))))))).((((((........))))))((((((.{{.(((.(((({{{{.(((((((.((((((.(((.......))).))))))((((.........)))).....)))))))}}}|{{{{..........}}})}.........))))))),},)))))).(((((((((((...................(((((((((((...(((((((((((((((...((((..(((.(((.((((((...)))))).)))...)))..))))....)))},))))))..)))))...))))).))))))......)))))))))))..)))))))))))},)}...})))))))))))))))),.))).)))))..)))))..))))))))))))))).......{(((......)))|(((((...........,,,....)))))},.((((.(((((........))))).)))).,.))))))).)))).......)))))}(((((...((((((((((((......)))).)))))).)).)))))..))))))....(((.(((((((.....,..((((((......))))))..,))))))))))..))),,......

Transcripts

ID Sequence Length GC content
GACGCGGUUCGCCGCAGGAGCCUCGAAGGCGCGGCGCCGGCGAGCCCUU… 4284 nt 0.5292
Showing 11 to 11 of 11 entries
Summary

This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]

Forensic Context

A systematic review of postmortem human brain studies found that the TJP2 mRNA, a tight junction protein, exhibited decreased transcription in the anterior cingulate cortex of individuals who died by suicide compared to controls [Yamamoto et al. DOI:10.3390/Ijms25115750].