| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACUCGCAGCCGCCGCAGCCUCGGCCGCCGGGCAAGUAGCUCCGAGCG… | 6769 nt | 0.4853 |
This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
A study in humans analyzing heart tissue samples from patients with various structural heart diseases identified a 62-gene expression signature, including the TLL2, which was significantly up-regulated in diseased samples (mean fold change 1.7020, adjusted p-value 1.9225 × 10^-32) [Fajarda et al. DOI:10.1186/s13040-020-00217-8].