| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCCCAGGACGGAAGUGGCCGAGAGAGUGUCGAAGGGAGGGCGAGGCC… | 8623 nt | 0.5735 |
This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
A study in humans identified Talin-1 (TLN1) as part of a six-protein panel with predictive value for sudden cardiac death risk in patients with hypertrophic cardiomyopathy, demonstrating high diagnostic accuracy when analyzed using ultraperformance liquid chromatography-tandem mass spectrometry [Cătinas & Hostiuc DOI:10.3390/ijms26146818].