Basic Information

Symbol
TLR1
RNA class
mRNA
Alias
Toll Like Receptor 1 Toll-Like Receptor 1 KIAA0012 Rsc786 CD281 Toll/Interleukin-1 Receptor-Like Protein TIL CD281 Antigen TIL. LPRS5
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_003263.4
Sequence length
2851.0 nt
GC content
0.3914

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-720.80 kcal/mol
Thermodynamic ensemble
Free energy: -778.91 kcal/mol
Frequency: 0.0000
Diversity: 788.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((....))...((((((.....))))))((((((.........((((((.((((((((((((.(((((((((.((((.((((.(((((....((((...(((((..((((((.(.((.((((((...(((((((((((...(((((.......)))))...((((((((...((((((..((((......((((..(((((((.........((((((((..(((((((..(((((...(((((..((((.(((((((...........))))).)).)))).............(((((((((....((((((((.(........).))))))))....(((((((......((((((((....((((..........))))......)))))))).(((((.....(((.((((.((((((.........)))))).))))..)))...))))).........(((((((((.(((..((((((((.((........)).)))))))))))...))))...))))).....)))))))....(((((((((((((((((((((((.(((........)))(((((.((((..((((...((((..(((.....((((.(((....((((.((((((((((((((((((.(((..((((.((((((((((((((...((.(((((((...........)))))))))...((((((.(((....))))))))).))))))..)))).)))).))))..))).)))......((((((....))))))..((((((....((((.(((...))).)))).(((((((.......)))))))((((...))))))))))............((((........))))(((..((((....))))..)))....((((....))))..)))))))))))..)))).)))).))).)))).....)))...))))...))))))))))))).))))))))))............................(.((((...((((((((((......)))))..)))))...)))).)(((((....)))))))).))).))))))).)))))))))....))))).)))))..))))))).))))))))....(((((((((((((((..((...(((((((...((((((.(((((...((((((((.......((.((......)).))........))))))))(((((((.(((((.....((((((.((((...(((((.....)))))..(((((((......((((.((((..(((.....(((((........))))).....)))..))))...)))).....)))))))..........(((((((((..(((((.((.(((((((.......(((((((((((........)))))...............(((((((...........((..(((((((....)))...))))..)).........))))))))))))).........)))))))..))..)))))))))))))).......)))))))))))))))..)))))))........((((((((...))))))))((((((...........(((((.((((..................)))))))))((((.(......).))))...............(((((((.((.....((((((((((..(((((...(((...(((((...))))).....))).............))))).........))))))))))..))..)))))))......(((..(((........)))..)))..)))))))))..)).)))))).......)))))))...)).))))).))))))))))(((.....)))))))))).....))))....))))(((((((.((((((...))).)))...)))))))..))))))...))))))))...((.....((((.((..(((((..(((..((((.(((....))).))))..)))..))))).....)).)))).....)).......)))))))))))....))))))..))).))))))...((.(((.....))).))......(((((((......((((((....(((((((((((((((.....((((...(((..((((.(((((.((((......)))).)))))..))))....)))..))))....))))).)))))..(((((((((((((....((((....(((((((((((.((((....((((((((((((.((.(((..(((..(((((..((....)).))))))))....))).)).))).))).)))))))))).)))..))))....))))....))))..))))))))))))).......(((((.....((((.(((((((((...................)))).)))))..)))).))))).....(((....)))..))))).....)))))).(((((((..((((((.((.......)))))))))))))))..)))))))..))))).))))...)))))))))))))((((.((.((((..((.(((.....))).))..)))).))..))))........))))))))).)))...)))..))))))))))))(((((......))))).))))))(((((((.....(((...(((((........))))))))..)))))))..(((((......))))).....(((((((...............)))))))...))).))))........
Thermodynamic Ensemble Prediction
.((((((({,..,{||.,.,(({,({{{{{||||||(((({{...,....,.{{{{{,|{{{||{{{{{,.{(((((({,.,((({{{,.,||||,,,,,||{{,,{|{||{{{((((,{({,...{((((.{({(((((.,((((((.{{{((,,.,,,.}}}}}.,,,|||{{{,....((,((((((((((..((((.....((((.((((.(((..{(((.,.}}}},,,,))))))).))))...,.))))..)))))))))}.}}.,,{{{.,,,|||...,,}},,,}},,.,,,,|{((({,,{....((((((((.{........}.)))))))),.,||||,.,,{{....((((((((....((((..........))))......)))))))).{{{||.....{{{.((((.((((((.........)))))).))))..)))..{|||||{{{.,,..{{{{{{{{,..{{{|,((((((((,((,.,,,,,.,,.}}}}}}}}|||.,.||||,.,,||||{{{{{,,,(((,..((((,(((((((,...((((((((((((.,.....,.|{{({{{(..,,|||||}}.....(((((((..(((((.{((({(,((((.....,,,.((((((((.(((.(((..((({.((((((((((((((...,(,(((((((...........)))))))})...((((({,(((....))))))))).))))))..)))).)))).})))..))).))}.,,.,,((((((....)))))}..((((((....((((.(((...))).)))).(((((((.......)))))))((((...))))))))))............((((........)))).((((((((.(((..{{({{{{,.(((((...,,{((((({{{.,,,((((((((((.{{{{,{...,|||..,{,{{,..|}|}},,,|||,|}|||||............,,))}}}}.............{((,{(((((..(((((((((.{{{{{......}))}|,.(((((((({..((.(((((....))))).}}...,....,{{{{....))))}.,..,})}})))))))}..|||||,},))))),....,.(((.((((...))))))).,{{....,,.))))))))}...))))))))}(((....)))....,,,,|,,|,.{((({,.,|||}|,,,.,|||,,|,.,,,}}}},,.,|,,})))))))))(((((.....)))))..(((((((.......,((.((((..(((...,,((({{..,,,,,.}}}}}.....)))..)))).,.,},......))))))).........((((.(((,{,{({{({....,,|||.,,........|,..{((((........))))}.{,{{.,,....,}.)))}))).)))).}}},)))),}}}))))}.}},},...)))}}............(((((({{{,.{((((((.,,......}}.)))))))}}),)))))).......))))))))))).....)))))))),},.....)))).))}}),,.)))))..)))))))...........(((((.((((..................))))))))){|{{,|,.....}.))}),.......,{{{...(((((((.,{...,.((((((((((.{(((((...{{(,.,{(({{,,,||}},..,.}))),............))))).........)))))))))).,,,..))))))).,.)))),,,)))))))))))))))))).,.))))}))}.,.,)))))|}}}||.,,,.,,,.}}},,})}.,,,))}))))))))))))),..)))))))))))))}.)))))||,.,,,,.(((((((.((((((...))).)))...)))))))..,})))),,,,}}))}))},,,},}}}.||}}}|,,,{{{{|,,|{{..((((.(({....))).)))).,}||{{|||||{,..,|{{|{|{{{...{{{..{{{{(({{{||,|||(((((((.((((..(((((....,..((((({.{(({.(((((.....,..(((((,{{..{{....}}..}}}..{(((((((((.{({.((((...(((,.((((.(((((.((((......)))).)))))..))))....}))..)))).}},))))).))))}..(((((((((((((....((((....(((((((((((.((((....((((((((((((.({.(((..(((..(((((..{{....)).})))))))....))).)).))).)))},))))))))).)))..))))....))))....))))..))))))))))))).)))))..,.....))))).))))))))).......))))).)))).)))}}))).}.}}.}}}}....}||{{,{|{{{||..}}},,.))))))},.,}}}}..((((((({{{(({((.((.....,.)))))))))))))))...,.})))}})))},........))))),))))}|,{((({,,.(((({.{{.(((.....))).,...},,,.,,.}))))..,.)))))))}}||||,}}}|,,}},..,}}}}}},,|{((((((......)))))))|{{{.,,,{|{,}}}}.,,,.,.(((((........))))),)))})))))))},{((((......))))).,,,.,,,{|||,,.....,.......})})))}...)))}})))........

Transcripts

ID Sequence Length GC content
ACAGACUGCCAAAUGGAACAGACAAGCAGGUUGUCUUGUGUUAAAGAAA… 2851 nt 0.3914
Summary

The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified TLR1 as a candidate mRNA marker for nasal mucosa detection via RNA sequencing, showing positive log2 fold change values in nasal samples [Chirnside et al. DOI:10.1016/j.fsigen.2020.102317].