Basic Information

Symbol
TLR3
RNA class
mRNA
Alias
Toll Like Receptor 3 Toll-Like Receptor 3 CD283 CD283 Antigen IIAE2 IMD83
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003265.3
Sequence length
6015.0 nt
GC content
0.3761

Transcripts

ID Sequence Length GC content
ACUUUCGAGAGUGCCGUCUAUUUGCCACACACUUCCCUGAUGAAAUGUC… 6015 nt 0.3761
Summary

The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It thus plays a role in host defense against multiple viruses. [provided by RefSeq, Jul 2021]

Forensic Context

A study in mice demonstrated that UVB radiation damages self noncoding RNA, such as U1 RNA, which is released from keratinocytes and acts as a damage-associated molecular pattern to induce TNF-α and IL-6 production via TLR3 and its adaptor TRIF, with Tlr3−/− mice showing reduced skin inflammation and impaired UVB-induced immunosuppression [Bernard et al. DOI:10.1038/nm.2861]. In humans, severe injury induces differential expression of 69 circulating miRNAs, with specific miRNAs like hsa-let-7b and hsa-miR-652 showing strong direct correlations with TLR3 gene expression in the peripheral blood of trauma patients [Uhlich et al. DOI:10.1016/j.surg.2014.06.017]. In humans, a transcriptomic analysis of bone marrow from severely injured trauma patients identified a unique upregulation of innate immune and erythropoiesis-inhibitory genes, including TLR4 pathway components, but noted that reductions in TLR3 gene transcription have been observed in peripheral blood following trauma [Kelly et al. DOI:10.1097/SHK.0000000000001826].