Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGUCCGGGAGGAGCCAACCGUGGCGCAGGCGGCGCGGGGAGGCGUCCC… | 4235 nt | 0.4420 |
Summary
This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
Forensic Context
A study in human burn patients identified the TLR5 as a key immune-related gene that is significantly up-regulated following injury and validated this finding in an external cohort and clinical blood samples [Niu et al. DOI:10.1093/jbcr/irad050]. In human sepsis patients, the TLR5 was found to be up-regulated in peripheral blood, primarily expressed in monocytes, and its high expression was positively associated with increased 28-day survival [Li et al. DOI:10.1515/biol-2022-0999].