Basic Information

Symbol
TLR5
RNA class
mRNA
Alias
Toll Like Receptor 5 TIL3 Toll/Interleukin-1 Receptor-Like Protein 3 Toll-Like Receptor 5 Systemic Lupus Erythematosus Susceptibility 1 MGC126430 MGC126431 FLJ10052 SLEB1 MELIOS SLE1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_003268.6
Sequence length
4235.0 nt
GC content
0.4420

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1182.10 kcal/mol
Thermodynamic ensemble
Free energy: -1257.66 kcal/mol
Frequency: 0.0000
Diversity: 1233.85
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((..(....)..))).))))).(((((((.((((((((........))))).)))))))))).((((.((((((((((.(..(......)..).))))))......((((((((((((...((((.....))))...))))(((((......))))).....(((((((((((((....(((..(((...(((((...(((..(((((((((((.((((...((((.....)))).))))........(((..((((((((((((................).)))))...........))))))..))).....(((((...(((((.........)))))...)))))..)))))))..))))..)))(((((....(((.(((((((.((((.....)))).)))))))))))))))....(((((.((((..........)))).)))))........................((((((((((((((((((((((.((((........))))(((((((.((((((...(((((.((.((((....(((((.............((((((...))))))))))).....)))).)).(((....)))......((.((((..(((((((.(((((((((((((((((((....((((....))))(((.....(((((((......)))....)))).....)))((((.....))))..(((((((((.........(((((.(((((((...((((((((........((((.(((....)))...))))...((.....))..((((....)))).)))))))))))))))......((.(((((.(....).))))).))....(((....)))......)))))......))))))))).....((((((......)))))).((((((((.(((((.(((((...((((..(((((((.(..((.((((((((.(((((....(((..((((((..((((...(((((.....(((((((((..((((((((...((((((((((...........))))))).))).......((((..((((......)))).))))....))))))))..))))))))).....))))).....((((......(((((((.(((((((((((((...)))).....)))).........(((((((.((((.......((...(((((((((..((((.((((((.............))))(((((((((((....((((.....)))))))))))))))....((...((((((((.......(((((((((((.(((((((((.((((..((((((((...((((((((....(((((........)))))((((....)))).........)))))))).......((((.....))))..))))))))....(((((((.((((....(((((((.......)))))))...)))).)))))))..((((((((((((...))))))))))))((((((...))))))......................)))).))))..)))))....(((((((((..((((((((((...))))))((((((((((((((((((((((((((.((..(((........((.(((((...))))))).........((((((..........))))))..(((((((((...............(((.........)))..(((((....)))))...(((((........................)))))(((((.....(((((((((((..........((((.(((((..(((......)))...)))))..)))))))))))..))))...(((..(((((...((((.....)))).)))))))).)))))......((((.(((((..((...(((((((.....(((....((((((..((((((........((((((((((((((((((..((..(((..((((((.((....................)).)))))))))..))..)))))))).))))))))))...........(((((((.....)))))))....................)))))))))))).....)))...............((((((((.(((((..........)))))...)))))))).......)))))))..))..))))).))))(((((((....)))))))...((((...)))).((((...(((((......))))).)))).)))))))))............((((((((........))))))))(((..........(((((..........))))).........)))(((.....((((.(((.....))).)))))))....)))..)).)))))))))))...............))))))))))).)))).))))..)))...)))))))))))))).)))...))))))))..))...))))))..)))))))))...))((((..........))))...)))).))))))).(((((((((.....)))))))))....))).)).))))))))))).......((((........))))....(((((((((.......))))))))))))))))))).)))..))))).))))))))....))..).)))))))..))))((((......))))......((((.......)))).((((......)))).....)))))..)))))....((((..((........))))))))))))))))))......)))))...)))..)))))))..))).))))..)))).)))))))...)))))).))))))).......(((((((((....))))).))))........))))))))))))))))))..)))))))))...)))..)))...))).))))))))))......(((((.(.(.((((.((....)).))))).).)))))(((((((.((((((((.((((((((((((((......(((.((.............)).))).........))))))...............(((((........)))))...(((((......)))))........................((((((.(..........))))))).))).))))).))))))))))))))).))))))))....................((((((((.................))))))))..........)))).))))..............(((((((((((((((.......(((((((((((((((.(((((((.((((......((.(((((((.((((..............)))).......(((..((((((((((.((.(((((....)))))(((((((((..((((((((((.((.(((((((.(((((......))))))))))))....(((((....)))))...(((((.((((.(((.((((((.............)))))).)))...)))))))))((((.............))))((((...........)))).(((((((.(((((..(((((((...)))))))..)))))((((.......)))).......((((((..........))))))....)))))))...........)).))))))))))))))...))))).(((((...(((....)))))))).....(((.............))).......)).))))))))))...)))...............(((.........))).....((((..(.(((((.....))))).)..))))...((((((.((....((((((...((((.(((.....))).))))))))))...))))))))..((((((((.(((.((((..((((((((.........)).)).))))..)))))))..((((((.....))))))..........))))))))..((((((((..(..((........))..)..))))...))))...))))))))).....)))).)))))))...)))))))))))))))((((...(((.((........)).)))...))))))))))...)))))))))
Thermodynamic Ensemble Prediction
{{{{,,(({{(,.,{{,.,,,,)))||.(((((((.((((((((........))))).)))))))))).,(((((({.,((((({(,,({,,,,.|{{|{|,||,|{{{.{{(,...))))))},,.((((.....)))).}}))))(((((......))))}....,|||||,||{{{{{,,,.{{{,.|{{...{{{{(..|{{...,,||||.|||.,{(((,..((((,,...}},,,)))},.....,{((({.((((,,{{{{,|.,||,..........,}|)))))|..,{{{,...,,,{{{{{{,|{{{,,((({({{{(|{,...,}},,..,,,,....}}|||,.,}}})))),})),,}.||||(({||{|{||,(({{{((,((({....,)))),}}}||}||{{,,,(((.{.(((((.((((..........)))).))))).}.}))..................((({((((((((((((((((((.{(((........)))}{((((((.((((({...{(((((({.{{(({...{((((............,|||{{(,.,})}}}}}}})),}...(((((((.((((.({{{,{{{((......,|.{((((,((((,,....,||}}.}}}}}.,...((({....}))){{(.....{(({(((......)))....}}}}.....))}.......}}})))}.)))))))))))........,,||}||{||},{{{|{|,,,({{.{{{{{{((({,(({..{{((..,.{{{,,,,.......)))..,},.)}}),})})|||||{.||||||,.{|...{{.(((((.,....}.))))).)|....(((....}}}.{,.,.,,,,{....,,|},{((((((((((((((((......)))))).......))))})))))){{|,{{{|,{,,{{,,,||.,.,|||{{{{.,,,,{{((({{(((,((((((.{{...,.,(((((((((,,{{{((,...((((((((.....{,..(((((....})))}.....,)),,...))))))))..|||.,{{{......||||,,,|||{{,((({{.{(((((((((,,((({{{{{{..,,...,,..,,,|{{{{{|.,,,,,((((((((,,.({{.{(((((......,,}))))}..|||,}}}}.})))....(((.....))).,|(({{,..,}}}}}{||||,,....,{{,,|||{((((((((((({{{{{{,,...}}))},})))))))))}..,}|{{{|,,.{({{.|{|..,|||,,.,}}},}.,||||||||,||{...((((((((...((((((((....(((((........)))))((({....}))).........)))))))).......,{{,.....,,,}..))))))))..{,{((((((.({{{|,{{{{{{,,|.},..,.)))}}})},,}}}}.))))))),.((((((((((((...)))))))))))){{||||,..}}}|||,.......,,}}.......,,,||||.}}}}..)))}}},..(((((((........)))))))......}}}}},,,,.,,.,,|||||(((((....}))}}||}..}}}}}||}||,,,}}})),}},,....,((({((({{{..,,,,,...}}))},..,.}}}},........,,},..|||||||,.....,{|||{.((((({,.,|||||,..{((((........................))))|(((((.....(((((((((((..........((((.(((((..(((......)))...)))))..)))))))))))..)))}...(((..(((((...((((.....)))).)))))))).))))),......,,,.,||{,.....,.,.,,,,,,,,,.|,,,,..{,{{||..|||||}},,.....((((((((((((((((((..((..(((.,((((({.((.,,..............},.)).)))))))))..))..)))))))).))))))))))...........||||||,}}}}}))))))}..,,,,,,,,,,,....,..,,||}}}}))))|...|}|}}}}}}.,}.}}}}}},|||||||,(((((..........))))).}}))))},,{{{{,.{{{|{{{,..,,,,,,}}}|,)}}}(((((((....))))))),,.,|||}}}))))}}...}}}|||||}}.}}},,,,,,}}}}|((((((((({{..........((((((((........)))))))){{{..........{{{((|......,,,}}||||,.......||,(({...,,{(((.(((.....))).)))}|||,|.....,{{{{{{|({,,...,,,...((((({{(..{((({,,(((((((,,,(((({.{,{.....,.....,|||..,,.,)))}|||,,,...(((..((({...})))..)))....,)}))},.)))))...))))}}}..}}}}}((((,..{(((((((.....)))))))))))).},||,|{|{,,....,,)))}}},.((((((((((...((((...(((((((((.{....,))))))))).)))).(((((((..({({{..,.}}},})},..)))))))........(((.((((......)))).))).............))))))))))..))})))))....}})})}))))}}....,|,..}},.)))))))))))|||{||||||..,|}}}..||,},||{{{||..,,))))))})}}}})),..,))))))))))),..)))))).))))))},..{{..{((|(((((....}}))).))),....},},)))))))))))))))))),|})}},,}}}..}))).,))|{{{|||...))))))),}}}},}|}||||||{}||||.||,},})}.}})))}}|}}},|((((({(.((((((((.((((((((((((({......{{{.{,...,|,..,....},.}}}.........}}}}}},..............(((((........)))))...(((((......)))))...........,......,.}...{{{{{,.,.......,,,))))))).}))}})))).))))))))))))))),}|||||||{...................{(((((({.................})))))))...,{,...,)},.,}}......,,))))),..{((((((((((((((...{,{((((((((((((((((,(((((((.((((......((.(((((({.((({.,..........|.}}}}....{,,({(,,((((((((((.({.(((((....}))))(((((((((..((((((((((.((.(((((((.(((((......))))))))))))....(((({....}))))...(((((.((((.(((.((((((.............)))))).)))...)))))))))((((.............}}}}.,||,,....||,,,||,,.{((((({.(((((.{(((((((...))))))),})))))((((.......)))).......((((((..........)))))),,..)))))))}},,,......)).))))))))))))))...))))).(((((...(((....))))))))..{,,({(........,,...))).......}).))))))))))...}}}.............,,||,.,{{,....))),....((((..{.(((((.....))))).}..)))).}.((((((.((.,{,((((((...|||({(({,....,,).)))))))))),..))))))))..((((((((.(((.((((..((((((({.........,,,)}.))))..))))))}..((((((.....))))))..........))))))))..((((((((..(..{(........}}..)..))))}..,)))...})))))))).....)))).))))))).,,)))))))))))))))))|...,{{{..,.....,,,}},|,....,)}.))))))...))))))))}

Transcripts

ID Sequence Length GC content
GCGUCCGGGAGGAGCCAACCGUGGCGCAGGCGGCGCGGGGAGGCGUCCC… 4235 nt 0.4420
Summary

This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]

Forensic Context

A study in human burn patients identified the TLR5 as a key immune-related gene that is significantly up-regulated following injury and validated this finding in an external cohort and clinical blood samples [Niu et al. DOI:10.1093/jbcr/irad050]. In human sepsis patients, the TLR5 was found to be up-regulated in peripheral blood, primarily expressed in monocytes, and its high expression was positively associated with increased 28-day survival [Li et al. DOI:10.1515/biol-2022-0999].