| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUUCUCUUCCUCCUGAAAGCAGAAGUGAUUCUUACGGAGAUGUCCAA… | 6709 nt | 0.4290 | |
| AAUUGUAUUUCCGUUCAUUUACAAGUUAUUUUCUCUUCUUCUGAAAAAG… | 6698 nt | 0.4279 |
The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
A study in humans identified the TLR6 as a differentially expressed gene in the dorsolateral prefrontal cortex associated with alcohol use disorder (AUD) and found it was significantly associated with problematic alcohol use in a genome-wide association study lookup [Willis et al. DOI:10.1038/S41380-024-02777-1].