| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUCAUCUCAGAAGACUCCAGAUAUAGGAUCACUCCAUGCCAUCAAGA… | 5003 nt | 0.4084 |
The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. The human TLR family comprises 11 members. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. For the recognition of structural components in foreign microorganisms, the various TLRs exhibit different patterns of expression as well; in this way for example, TLR-3, -7, and -8 are essential in the recognition of single-stranded RNA viruses. TLR7 senses single-stranded RNA oligonucleotides containing guanosine- and uridine-rich sequences from RNA viruses, a recognition occuring in the endosomes of plasmacytoid dendritic cells and B cells. This gene is predominantly expressed in lung, placenta, and spleen, and is phylogenetically related and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Aug 2020]
A study in humans demonstrated that the TLR7 was significantly upregulated in classical and non-classical monocytes from patients with plaque rupture in acute myocardial infarction, associating it with a pro-inflammatory state [Qian et al. DOI:10.3389/fimmu.2022.908815]. Another human study found the TLR7 was upregulated in the brain as part of Toll-like receptor signalling in post-mortem tissue from individuals who succumbed to septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in humans demonstrated that severe trauma induces a unique bone marrow transcriptomic signature characterized by upregulation of genes involved in innate immunity and erythropoiesis inhibition [Kelly et al. DOI:10.1097/SHK.0000000000001826].