| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGGCCUUCGGUGGUGAACGAGUCUCCAGCACCAUGUCUGGUUUGUCUG… | 4109 nt | 0.4023 |
This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8. [provided by RefSeq, Jul 2008]
A study in zebrafish demonstrated that the TMED10 transcript, a vesicular trafficking protein, increased in relative abundance within 0.3 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].