Basic Information

Symbol
TMED10
RNA class
mRNA
Alias
Transmembrane P24 Trafficking Protein 10 P24delta1 TMP21 P23 P24(DELTA) P24d1 Transmembrane Emp24 Domain-Containing Protein 10 Transmembrane Protein Tmp21 P24 Family Protein Delta-1 S31III125 Tmp-21-I P24delta S31I125 Transmembrane Emp24-Like Trafficking Protein 10 (Yeast) Transmembrane Emp24-Like Trafficking Protein 10 21 KDa Transmembrane Trafficking Protein 21 KDa Transmembrane-Trafficking Protein Testicular Tissue Protein Li 206 Protein TMED10
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_006827.6
Sequence length
4109.0 nt
GC content
0.4023

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1088.30 kcal/mol
Thermodynamic ensemble
Free energy: -1170.77 kcal/mol
Frequency: 0.0000
Diversity: 1120.85
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((....((((.((..........)).))))..))))(((((.(((((((...((((((((((..((((((((..(((((.((..(((((((.(((((((((((.(((((((((((((...(..(((((........((((((...(((...(((.((.(((..(((((....))))).))))).))).)))...))).)))...)))))..).))))))))))))).)).((((.((....)).)))).((((((((..((((((((.((((...((((((((.......))))))))...)).)).)).)))))).......((((..((((........))))..)))).)))))))))))..)))))))))))))..))))))).....(((.((((((((.((((((.(((..(((...((((((((....(((((((......((((((((.(((((..(((......))).)))))(((.(((.((((((((((..(((((((..........))))))).(((.((((.((((((....((((((((((.(((.(((..(((((........))))))))........)))))))))))))....)))).)))))))))....(((....)))))))))))))...))).)))(((..(((((.....(((((((..(((..........((((.(((((((((((((............(((((........)))))...((((((......)))))).((.(((((.(..((.....))..)))))))).......(((((((........))))))))))))))))..(((((((.....))).))))..(((((((((.((.............((((((((((....((((((......((((...((((((....((((.((((............(((((((..(((((((((((((........))).)))).)))))).)))))))))))))))..)))))).))))............((((.((((...))))..))))........)))))).))))))))))............)).))))))))).....)))))))))))..)))))))))))).)))......)))))))))))))))..(((..((((((.((((((((((((((..((((((((((..((((.((((((.......)))))).)))).))))))..))))((((....))))((...((((((.((((((((((((.......((((......)))).......(((((((((.((((.(((((......(((((((.((((((((........)))))......(((((((........)))))))....)))))).((.(((((((((((...((((((.((((...((((.(((........)))..))))....))))........................))))))....)))))))))))))....(((.((((..(((.(((((.........(((((((......)))))))))))))))..)))))))(((((...........)))))...........))))......))))).))))...)))))))))......((((((....((((((((.((((...)))).))))))))(((....))).....(((((((((((.....))))).)))).))(((((((((((((......)))))))((((((((..(..((((((....))))))..)..)))).....)))).))))))))))))..)))))))))))).))))))...)).......)))))).)))))))))))).))..)))))))).)))...))).)))))))))..))))))))..)))...))))))))..).)))))))))((((.......)))).......((((((((((.................((((((((...............))))))))...((((.((.(((....))).))))))....)))))))).))(((((((((((((((((((((..(((((((((..((((((((((((((((((....))))).))))...((((((((.(((((..(((((.......(((((.......(((.(((((........))))))))..)))))..(((((((((((..(((.(.((((((.(((.((((((((.(((......(((((((.((((((..((((((((((((.(((((((((((..((((((.........))))))..)))))....((((((((((((...(((.(((((.......((((.....)))).......))))).))))))))((((.((((((..((.....(((((((((((.................))).))))))))......(((((.........))))))).)))))))))).((((....))))......))))))).......)))))))))))......))))))).)))))).))))))).............))).))))))))..))).))))))...).)))((((((....))))))..........(((((((.(((((...................((((((.((((.((((........))))...))))))))))..(((((.(((...))))))))....))))))))))))((((.(((((((...(((.((((((...(((..(((....)))((..((((((......))))))..))((((.(((....((.((((((.((..(((((((.(((((.((..(((.......((((.((((.....))))..))))........))).))))))).))))))).)))))))))))))..).)))....))).)))))).)))...)))))))))))....((((...(((((((((..((((.(((((((.((((.(((((.((.......)).))))).)....))).)))))))))))..)).)))))))...)))).......((((((.....))))))......)))))))))))....))))).))))).))))))))))))))))).......................((((((..((((..((((..(((((.....(((((((.(((((((((.((((.........)).)).))))..)))))...)))))))...)))))..))))..))))..)))))))))))).)))..)))).((((.....))))..(((((((((((((((((.(((.....))).)))))).........))))))))))).((((..........)))).(((((((((((...((....)).(((((.((.((((((.......((....)).......)))))))).(((.(((((....))))).))).............((((((((((......((((...))))........))))).)))))......(((....)))..((((((((..((.((((((..((((.((((..((((((......)))))))))).))))...)))))).)).....))))))))((((((((.((((((((((((((((((.............)))).))).))))......(((((((..............................)))))))...((.((((((.....((((.(((...(((((.((((((............)))))))))))..))).))))..))))))))(((((..(((((......)))))......(((((..((((((((............))))))))))))).....(((((...........((((.((((..(((((((....))))..))).....)))).)))))))))..)))))..((((((.....))))))..))))))))))))))).)))))......)))).)))))))))))))))))..))))))).((((.(........).))))....)))))).).))))).
Thermodynamic Ensemble Prediction
,((({....(((({((..,.,,.,.{||,||}}..)}))||{{{,{||(({{,,,||{{|{|(((.,(({{{{{,..(((((.((.,((((,,,,({{{({(((((.(((((((((((((...(..(((((........{((({{...{((...(((.((.(((..(((((....))))).))))).))).)))...}))}),)...)))))..,.))))))))))))).)|,{|||}||..,,)),))},,|||{{{,...{{{,((((,((((,,.((((((((.......))))))))...}}..|,|||||||||,......,(((,.{(((..,....,||||,,|}||{||,,,|||||}.,|||}}||||}}}}..}))))}}....,{(({{(({{{{{,||||{{,.(((((((((((((((((....((((.(((((((....((((...(((((..(((......))).))))).)))),,,(({{((((({.((((((((,...{{{{{.{{{{{((((....,((((((((({{,.((((((((((.(((.(((..(((((........)))))))}........})}))))))))))....}}}}.{(((((({{{((.,.....,.((((((.....)))))).,.(((((((((..(((((........))).))..}))).)))))......(((((((((...(,,,.,{,.(((((........)))))}|.||||((,{,...||||,,.{,.(((((.{,.{{.....)),.,)))))}}...,...|||||{(,,,,....,}))))))))))))))..(((((((.....))).))))...))))))))))}.,})))))),,..,,,)))))))))))))}.))))))}.,....,}))|||,....}}}.((({....}))).....(((((((..(((((((((((((........)))))})),}))))).)))))))))))))).))))...,,,.))}))..........(((.,{((,..}})),.))))))))))))))}|||.{{{{{{,{{{{,...{{{{{,{{{(({,,{{{{{{(,..(({{(({{{{....||,,,|||,.|||||,......................({{,,{{(({{(((((((((((((((..((((((((((..((((.((((((.......)))))).)))).))))))..))))((((....))))((...((((((.((((((((((((.......((((.,,,,,||||..,,,,,.,{{{{{((.,,..,||.{|||.....},}|,|||{|{{{{{........|||||,|,,..{({((((........))}||}|......,,,|,.{{((((((({{{{,,,|||{{{,{{||...,{{{.(((,,,.....}}},.|}}|....|}},........................})))))....))})))}})}},},......,{{{{,,{{(..(((((({(,,,.,(((.((({{{{{{..,,,||{..{(({....))),}.,}}|,.....}}}}}})))})}..}},..}})))))}.....}}}}.,}}|||{((((|(({..{{{{....{{{....,,,,,,{{|}||{{,,,))))})}}}))))),,,})).,.})},,}}.}}}|||||....,))))).}}||||,,|{||||||||{(...,..}}}}}}|(((((({(..{..((((((....))))))..)..)))),..,})))))}},,)}))))))}})))))))))))).))))))...)).......)))))).)))))))))))).}),.})),....,||||,.}}},}},,)))))..}}})))),..,}}...})}))))),,)})}))))))}||||}}..,}})),,.},,,,.||||||||||.,,,,.,,,,,......((((((((.,,.........,,.)))))))),},||,||||,|||....))).)))))}...,)))}}}}},},((((((((((((((((((((....}}}},..,,.,,.,.((((((((((((((((((.{{|{{{|||.{{({,,..,|||,|||,{,|||||..,{,{{{|{.,,,}..}}}}|{{{||....,},)})}}.,,,.))))))))))}..(((((((.(((((.....)))))..(((((((.,((((..{(((((((((({{((((((({....(((((.(((((((((((..((((((.,.....,.))))))..)))))....((((((((((((...(((,(((({.......((((.....)))}.......})))),))})))))((((.((((((..{{.....(((((((((((.................})).)))))))).,....(((((.,.....,.))))))}.)))))))))).((((....))))......))))))).......)))))))))))...(((((((((.(((((((((((....)))...,||,...,,......((({..{(((((.(((((((({...})))))))).(((((,{{.....,,))))).....,,......}})))))))))...((((((.((({,((({........})))...}))))))))}..(((((.{{,...,}})))))((((((..........)))))),,}}.))))..)))))))))})))}},|||}...,,,.,..((((((......))))))..,))))))))))))))))))))))..)))))))))))).))}).},,|..}},,...|{({....,}})...((((((((((((((...{{((((....,.{{(((((...,....{,{,.,,{({({{.(((({,..{(((((,|{...{{{{{.{{{.,{,..((((...(((((((((..((((.(((((((.(((({(((((.((.,....,)).))))).),...))).)))))))))))..))}}))))))...))))..},,.,|||,||}}}..}},,}}.))))))))))).))),.}}}),})))))))..,....)))))}{{{.......},,,..............{{(((((.,((((..((((..(((((.....(((((((.(((((((((.((((.........)).)).))))..)))))...)))))))...)))))..))))..))))..)))))),)))))).)))))))).((((.....))))..(((((((((((,,,(({..,({{.,,.}},)),))).........))))))))))).((((..,....,..)))).(((((((((((.,{({..,,),.(((((.((.((((((.......((....)).......)))))))).{{{.(((({....})))).|||,........,,,.((((((((((......{(((...})))........))))).)))))...,{{{{,....})),,((((((((..{{.((((((..((((.(((({,,{(({{......))}})))))).))))...)))))).}}.....))))))))((((((((.(((((((((((((({{{,.,,,,{{{{,..{||||{||,.||||,,....{((((((..........,,.....,,...........))))))}..,{{{((((((||{,,{{|{|{{{...{((({,((((((((......}},}}}}})}}},}},|}}}},|}}},}}}}}),,||||,,}||{||,.....))))}......(((({..((((((((............)))))))}})))).....||{{{||,,,,,,,..{{({.{{{{.|{{|||||,,,.,}},..})),}},,}))).)}))}|||}...)))}..((((((.....))))))..))))))})))))))).)))))......)))),})))))).}))))))))..))))))}..,{|.|,},,,,,,),),,.....)))))),),))}}}.

Transcripts

ID Sequence Length GC content
GAGGCCUUCGGUGGUGAACGAGUCUCCAGCACCAUGUCUGGUUUGUCUG… 4109 nt 0.4023
Summary

This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8. [provided by RefSeq, Jul 2008]

Forensic Context

A study in zebrafish demonstrated that the TMED10 transcript, a vesicular trafficking protein, increased in relative abundance within 0.3 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].