| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCCAGCUGAGUCCUGAGCAGCAGCCCAGCGCAGCCACCGAGACACCA… | 506 nt | 0.6265 |
This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product. [provided by RefSeq, Jun 2015]
A study in humans demonstrated that the BGLAP was identified as a high-confidence gene in common between mice and humans within the top 10% of genes related to lifetime alcohol consumption [Farris et al. DOI:10.1038/Mp.2014.159].