| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGUGGAGCAAGAUGGCUGUGGAGCUGGGCGUGCUGCUCGUCCGGCCCC… | 2546 nt | 0.5448 |
This gene is a member of a family of genes encoding transport proteins located in the endoplasmic reticulum and the Golgi. A similar gene in mouse is the target of microRNA miR-296, which is part of an imprinted cluster. [provided by RefSeq, Jul 2016]
A study in human patients with sepsis demonstrated that the TMED9 exhibited increased polyadenylation in whole blood samples from individuals with viral infection compared to those with bacterial infection [He et al. DOI:10.1186/s12879-025-11078-z].