| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCGCCAGCCCAGAGCAGCCCCGGGCACCAGCACGGACUCUCUCUUCC… | 2662 nt | 0.5883 |
Involved in positive regulation of bone mineralization; positive regulation of osteoblast differentiation; and positive regulation of osteoblast proliferation. Located in plasma membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the TMEM119 was specifically expressed in sorted microglial populations, serving as a cell-type assay control marker to validate the purity and sensitivity of fluorescence-activated cell sorting procedures following spinal cord injury [Stewart et al. DOI:10.1186/s12974-021-02161-8]. A study in mice demonstrated that the TMEM119 mRNA levels changed following a cryolesion-induced traumatic brain injury, though the observed fold change was lower than 2.5 [Sanchis et al. DOI:10.1002/glia.23758].