Basic Information

Symbol
BGN
RNA class
mRNA
Alias
Biglycan SLRR1A DSPG1 PG-S1 Dermatan Sulphate Proteoglycan I Bone/Cartilage Proteoglycan-I Small Leucine-Rich Protein 1A Bone/Cartilage Proteoglycan I Biglycan Proteoglycan SEMDX MRLS PGI
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_001711.6
Sequence length
2353.0 nt
GC content
0.6090

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-844.30 kcal/mol
Thermodynamic ensemble
Free energy: -885.07 kcal/mol
Frequency: 0.0000
Diversity: 740.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((............)))).)))..((((((.((.(((((..(....)..))))).)).)).)).))((((((((.((((((.(((...((......((((..((((((((((.((((((((((((((((.(((.(.(.((((.(((((....)).))).))))...).).))).)))).((.(((((........(((((((.((((((..(((((((...((.((((((.((((........(.(((((((.((((((((((((((((((.........))))))).(((((.((.(.((((...........)))).)))..).))))....((((((..(((((.....((((((((.((((((((.....((((((........).)))))..)))(((((((.(((((((.((((..((((..((((((.....(((.(((.(.(((((((((.(((.(((((...))))))))..((((...(((....)))...))))........(((((...)))))........(((.....)))...))))).))))).))).).))..........(((.((((((((.((((.(((((((((.((....(((.((.....((((((.((((...(((..(....(((.((....))))).....)..)))....))))))))))......)).)))....).).)))))))))..((((((.....)))))).........((((((.((((((((((((..((.((......)).)).((((((.((.....((...(((.....))).))....))))))))..(((..((.....))..)))..............))))))))))))(((((((.((((....(((......)))....)))).(((((...((......)).(((((...)))))......((((((....)))))).))))).)))))))..))))))..(((.((((.....)))).)))(((.((((...)))).)))..........)))).))))))))))).)))))).)))).............)))))))))))..(((....)))....((((..((((((((((.(((((.........))).....)).))))....)))))).))))....)))))))(((((.((.......)))))))..)))))))))))))((((.......))))..((((.....)))).)))))..)))))).....(((((.((.(((((((...(((((..((.(((((((.....))).((((..(((..(((......)))..)))....)))))))).))....))))).)))))))((.(((((...))))).))...)).)))))......((((((...(((((.(((((((.(((((((((.((........)).))))))...))).)))))))....(((((.......)))))........)))))...)))))).......))))))))))).)))))))).......))))..)))))).))....)))))))(((((...(((((((((...((((.(((((((((((((....(((.(((((((...(((...((((((((((((((((..(.(((.(((((((((..(.......((.((.(((((((...(((................((((.(((((((......)))).....)))))))...((((.((......(((....)))....)).))))....((.(((.........))).))..................................................)))...))))))).).).).).......)..))))))))).)).).)..))))...((((((...........))))))...))))))).((((.............)))))))))...)))))))))))))..........(((.(((.....)))..)))...))))))))))))).))))..(((..((.....))....)))........))))))))).....)))))..))))).).)))))))))))).)).....(((((.(.(((...))).).))))))))))).))))))))))......)))))).))))......(((((.....(((...)))..)))))........((((((((.....(.((((.(((..((.((..(((.....)))..))))..))).)))).)....))))))))))..))).))).)))))))))))..............(((........)))
Thermodynamic Ensemble Prediction
..,...,(,,.....{{.((((((((((..,,,{{,...((,.(((.((((((((((.(((.(((.((({(((.(((((,(((((({,(((...({,,....((((({..((((..((((((.,.......((((.{{{,..{,{.,},)),.|,,}.))))))..)))}....)))))},,}|.}}.,||{...}}}....(((.(((((((,,.((((((((...,({((((((.((((........(.(((((((.((((((((((((((((((({....||{{{||||,.{|,|||||.{.,||||...,,,....,}}}}}}}..|,|||{..{{((,,((.{((((({{{..,,|||||,.||||||.|}}}..{{|((({{..{,{{{{||||..{{{{((((({,,((({{((.{({(({((((..(({,(,.....{.|.,,|,|,||{{{{||..(({,({{{,...||}}}}}},,||{|...,{{,,,,))),.,))))........{{||{,..})))}..,|,|..{{{.....|||,.{|||||..|||{{||..|{{{{{{.......{(,{((((((((.((((.(((((((((.,,...,(((.,,.}}}}((((((.((((...(((..(....(((,({....))))).....)..)))....))))))))))......|}.}}}..,.,.).)))))))))..((((((.....))))))..,,,,..,((({(({((((((((((((..((.((......)).)).((((((.((.....{{...|{|.....},,.}}....))))))))..{{{..{{.....,,..,}}..............))))))))))),{((((({.{{{(....(({......)))....}})),|{(((,,,||,,.,..,,.(((({...})))),.,...((((((,,,,))}})).}}}},.}}})}))|,|}}}||{{(((.((((.....)))).)))|||.|{{|...)))),))).,..,}},,,)))).)))))))))}}.,,}|||.,}},.,.......,,,,|}|||||||||..{{{....,||(({.((((..((((((((((.(((({.........))}....,)),)))),...}))))).))))...}))))|||(((({,((.......)))))))},),,})))))}}))|{{|,,,,.,,)))}..,{,{.....)))),))),,}}))))),.}}}}))))}.}}}|{||||||||||{|||..,,,,|||||||{{..((((((((.(((..{|{..,...}}}..|}|.((({{..{,(({(({{.,|{},||,{|,...,{.(((((...))))).})...{{{{,,,))))...(((,,,...,|||,.,{,,|||.||{||||||}||,.}}}}}.))})))))),.,))),},}})))}...(((((.......)))))........,}}},}}})))))).}}}},,))))))))))).))))))),,......))))..)))))).))....))))))))(((((({({{{{{(({{,,{.,{,||||(((,((((,....{,..((((((((,(((({.{({.{((({{((((((...(((((((((,...|)}})))..............((.......)}...............)))..))))))..,,,..)))))....})}}}}}}}.,|.)))))))}..,.))))))),,,..,||||}},...}}}|||,........)))))))}...............,,,}}}}}}}.......................))).).))),))).),,})).)))}))).))).))).)).)))))))).))),..,|.||},.....)})))))))),)}..{((((,,,(((,{{,{{{,,,,.{,}|||{{|||...))),,,......,.........,(((((({.....{{|..{{((,(((,{,(({..{{|.|{||||(({{({,.,,}})}|,{{{............}}}))}}|||||.......})},,|}}}.}}}))))).,,|,...,,,..||,..,,}..})))})))))))))))))))))))}},))),..,,)}}))||{{,,..}}}}.,,{|}|}|}|,,.{{|,|{{{{|,,..{,,((,((((((((.,...(.((((.(((..((.((.,(((.....})),,.)),.,))).)))).)...,)))))))).}}}))),)))})))),}))||(({.....,}}))..,,,,},},...}},

Transcripts

ID Sequence Length GC content
CUCUCUCCACAAACUGCCCAGGAGUGAGUAGCUGCUUUCGGUCCGCCGG… 2353 nt 0.6090
Summary

This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein, which plays a role in bone growth, muscle development and regeneration, and collagen fibril assembly in multiple tissues. This protein may also regulate inflammation and innate immunity. Additionally, the encoded protein may contribute to atherosclerosis and aortic valve stenosis in human patients. This gene and the related gene decorin are thought to be the result of a gene duplication. [provided by RefSeq, Nov 2015]

Forensic Context

A study in mice identified the BGN as a hub gene with the largest degree of connectivity in the protein-protein interaction network of common upregulated mRNAs during fracture healing and as an upregulated targeted mRNA in the constructed miRNA regulatory network [Li et al. DOI:10.1155/2021/2866475].