Basic Information

Symbol
BHLHE40
RNA class
mRNA
Alias
Basic Helix-Loop-Helix Family Member E40 SHARP2 DEC1 Clast5 BHLHB2 STRA13 Basic Helix-Loop-Helix Domain Containing, Class B, 2 Differentiated Embryo Chondrocyte Expressed Gene 1 Differentially Expressed In Chondrocytes Protein 1 Enhancer-Of-Split And Hairy-Related Protein 2 Stimulated By Retinoic Acid Gene 13 Protein Differentially Expressed In Chondrocytes 1 Class E Basic Helix-Loop-Helix Protein 40 Class B Basic Helix-Loop-Helix Protein 2 SHARP-2 Basic Helix-Loop-Helix Family, Member E40 BHLHe40 Stra14 BHLHb2 HLHB2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_003670.3
Sequence length
3152.0 nt
GC content
0.5003

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1017.10 kcal/mol
Thermodynamic ensemble
Free energy: -1076.60 kcal/mol
Frequency: 0.0000
Diversity: 904.53
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((.((((.(((((((((((.(((.((((((((.(..(((((((((...(((((((((((((.(((.(..(((..(((.((((.((..(.(((((((((....((((...((..((((((((((......).))))....))))).))))))........(((......))).(((((....((((((((((............))))))...))))))))).......((((((((....)).....)))))).))).)))))).)..)).))))))).)))..).)))...)))))))).(((((((((((..(((.........))).))))..((.(((((.((((((...(((((.....)))))...((.(((((.....))))).))......(((..((((.((...((((((((....(((((((((.((....((.(((((((.(((.((...........))))))))).........)))...)).....)).))).))))))..((((....((((((........))))))....)))).....(((....(((((((.((((((....(((.((((((..((((..(((......)))....((((..((((.......)))).))))..)))).)))))).)))))))))...)))))))....))).....((((((..(((.(((((((((..((...(((((..((.((((....)).))..))...))))))).)))...)))))))))..))))))..)))))))).))))))..)))((((.....)))))))))).)...)))).)))))))))...(((..((((((((((................)))))).))))..)))........(((((((((((..(((((..((((((((..(((...((((.....))))..)))...))))))))((((....))))(((((((((((((((((.((.((((((........((((...(((((((.((((((((((((((((((((((.(((((((....))))...........))).).))))))))......((.((((((((..(((((......))............................((((.((..((.(((((((.....)))))))((..(((((...)))))..))....))..)).)))).((((......)))).....))))))))))).)).)))))))).)).))).....((((((((...((......))...)))))))).(((((((((((.........))))))))))).......(((......)))((((..(((.........(((.....((.((.(((.....))).)).))....)))..)))..))))......)))))))...))))........)))))).(((......)))..(((.((.....)).)))......(((((......((((..........)))).......))))).)))))))))))))))))))......(((...........))).((((((....)))))).(((((.(((....))).)))))..............)))))..))).)))))))))))))...)))))))))...).)))))).)).))).))))).)))))).)).)).)))(((.((((.((((((...((((....((((((((((((((........)))).))))))..)))).(((((.(((((.(((((((((......((.....((((((..........)))))).....))))))))))).(((......(((((((....((((((((.........(((((((((((((((..(((((((((((((((((((..((((((.....((((....)))).....)))))).....)))))))))))))))...((....(((.......)))...))....))))..)).)))))))).)))))(((((((.(((((.((.(((((.((..(((.(((.((......)).))).))).))..)))))...))..(((((.((..(((((((....((...))....))))))).)))))))..((((..(((.......)))..))))((((..........)))).(((((((((((.(((((.(((....((((((..(((...((((((((((.....((((((((((((((((((...(((..((((.((....(((((((((((........((((.....)))).((........)).)))))).)))))))))))..))).))))..((((......))))..((((((((((......(((...........)))......))))))))))....))).))).....)))))))).....))))))))))..))).)))))).((((...))))......))).)))))...))))))))))).))))).)))..))))..(((((..((((((.........)))))))))))..........))))))))......)))))))......)))))))).))))))))).))))))..)))))))......((((..((((.(((...((..(((((..((......))......(((((((.......(((((((((..............(((((((((.....)))))))))..............))))))))))))))))((..((((.((.((((....)))).)).))))..)).(((.(((((.........((((..(((.((((((.(((((((((......))))))))).)))))).)))))))(((((((((.(((...(((((....)))))...))).))))))))).(((((......)))))..(((((((((((((((((((.(((((.....((..(((((((((...)))))))))..)).......))))).))))))))))))).))))))...(((((((.......)))))))........(((((((........)))))))))))).)))........)))))..)))))))))))))(((((.....)))))
Thermodynamic Ensemble Prediction
...(((.((((.(((((((((((.(((.((((((((.(..(((((((((,{{,{{,(((((((((.(((.(..(((..(({,((((.((..(((((((((((.,,,((((..,((..((((((((((......),})))....))))).))))))........(((......))).(((((....((((((((((..,......}..))))))...))))))))).....,.{((((({{....}}.....)))))),))},))))))})).)).))))))).)))..).)))...))))))))).......{(((..(({,{.....,,))).)))),}|||((((.(((,.({{..(((((.....)))))..,{(.((({{,..,.)}}}},||,{{({.(((((....,{((({(({{({(({(,{(((,{.,,,.......((((..,|||},{,,{........,,{{{|,||||||,....{{,||,|.}})|||,|||,.{{{.}}}))},{(((({...,,,..,........))))))}{{{|||,......}}|||,{||,}|,.,,,}}},,}.||}}||||,,,.{{{,..,{,......,,}.,,.((((..((({.......}))).)))).|}}})|))}|},,)))||{((((((.{((((((({..,,,....((((((..(((.(((((((((..((...(((((..({.((((....)).))..}},,.))))))).)))}..}))))))))..)))))).,{{{{,.(((((((.....((((((.....)))))).....))))))).({.(((({{{,,.(((..((((((((((................)))))).))))..)))...,|||,||{,(((((((...))}})))},|{{{{||||....,(((..|.,}|}|,.,,},|{|}}}},}||||{....))})|(((,(({(((((((((.{..,.((.{,.{(.((((.((,..(((((.(.((((((((((((((((((((({.((({{({.,,,||,,{{{....})}.))),).))))))))......((.((((((((..(((((......))....,{{,,...................((((.((,.((.(((((((.....)))))))((..(((((...)))))..))....))..)}.)))).((((......)))).....))))))))))).)).)))))))).}),))),...)))))))).)))).}}..,})}},.,||{((||,(((((((((((.........)))))))))))....,.{(((......)))}}}||,}}{||..,}}}},)),.,.,{,.,,.||{...,.}}}.})}}}.,..}}}}.,)})}},)}))),...)))))))}.).))))))))),))))))}|,}},}})))))}))))))..|||.,}.}}}...|||||,,|,.....{{{{.......,,.,,,,....,.,,)))}.)}))))),,|{((((((((.,(((({{,...........|||,((((({....)))))).,{|||,{{,{{{{|||{,||,,,.....,.,}.}}}))))))))).}.)))))))))).,,,,))))))))),}.).)))))).)).))).))))).)))))).)).)).))}(((({({{.{{{{{{.,.((((,...((((((((((((((........)))).)))))}..}|||,{{{{{,({{{{,{(((((((({..,,.,({{...,|||,|....}}}}}.)))))},.,..,,},}}}}}||,.,,.},,..{{{{{{{....{{{((({{,{||.|||{((((({{{(((,{{,..(((((((((((((((((((,.(({{{{.....((({,..,||}}....,))))))..,},))))))))))))))}...})))..|||,,.....}},..{{{{{{,.{{.{{||{||,,,,,,..,,))}}}||,||,||||.||}|,|||,}||||||,|(({({.,{.,.||,||},}|||||,.|{|||...,|..(((((.((..{((((((....((...))....)))))))}),))))).{{{{{{..,..,{,{..{{,{{|,,.}}}}}}}.,))))}}.||.{((((((((((.(((((.(((....((((((..(((...((((((((((.....((((((((((((((((({...(((..(({{{(,...{(((((((((((........((((.....)))).((........)).)))))),}))))))))))..})).)})},.((((......))))..((((((((((......(((...........)))......)))))))))).,}}))).))),....)))))))).....))))))))))..))).)))))}.{{{,,..}))),...,.))).)))))...))))))))))},|,..((((....)))).,,||{|.{(((((.,,....,,))))))})}}},}}},,,...))))}}},..,,,,))))))).,..,,}))))))),))))))))).)))))).,)))))}},,....,,,,..((({.{{(..,{{..(((({..{{,.....}}...,,,{{{{{{{,..........((((.........))))..{((((((((.....))))))))},,,(((,,{,{||||}||,.,||}}}}}},,,,,|{,|,||.,|||}}},)))),,}.}}}}..}},{{{.{((((,.,...,,,,{{{,,(((.{{{{{,.(((((((((......,,)))))))))})))),}))}}}|(((((((((,(((,..(((({....))))).,,))).))))))))),,{{{{......}}}}|,,{((((((((((((((((((.(((((.....{(..(((((((((...)))))))))..}).......))))).))))))))))))).)))))}.|.(((((((.......)))))))}..,....{((((((........))))))}})))),))).....,,,)))))..)))))))))}}}}{{{{{.....)))),

Transcripts

ID Sequence Length GC content
AUUCACUUGGCUCGCACGGCGCAGACAGACCGCGCAGGGAGCACACACC… 3152 nt 0.5003
Summary

This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with ARNTL or compete for E-box binding sites in the promoter of PER1 and repress CLOCK/ARNTL's transactivation of PER1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]

Forensic Context

A study in humans identified the BHLHE40 as a differentially expressed circadian rhythm-related gene between sepsis patients and healthy controls, with its expression validated by RT-qPCR [Wang et al. DOI:10.3390/ijms26093993].