| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACUCAGUGCUCCCUCCUCCUCCCGCGCCCCGCGCUCUGCGCGCUGAG… | 5342 nt | 0.3897 |
Predicted to act upstream of or within negative regulation of retinal cell programmed cell death and sprouting angiogenesis. Predicted to be located in membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the TMEM215 is enriched in cortical layers 2/3 of the medial prefrontal cortex, specifically within Visium spatial cluster 8, as identified through spatial transcriptomic profiling in a model of alcohol dependence [Salem et al. DOI:10.1016/J.Nbd.2023.106361].