Basic Information

Symbol
BHLHE41
RNA class
mRNA
Alias
Basic Helix-Loop-Helix Family Member E41 SHARP1 DEC2 Enhancer-Of-Split And Hairy-Related Protein 1 SHARP-1 BHLHB3 Basic Helix-Loop-Helix Domain Containing, Class B, 3 Differentially Expressed In Chondrocytes Protein 2 Class E Basic Helix-Loop-Helix Protein 41 HDEC2 Differentially Expressed In Chondrocytes 2 Basic Helix-Loop-Helix Family, Member E41 Class B Basic Helix-Loop-Helix Protein 3 BHLHe41 BHLHb3 FNSS1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_030762.3
Sequence length
3743.0 nt
GC content
0.4902

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1232.60 kcal/mol
Thermodynamic ensemble
Free energy: -1299.05 kcal/mol
Frequency: 0.0000
Diversity: 762.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((((((((........))).)))).))))))(((..((.(((((((((((.((((((((.(((......))).))))((((((((.((........)).)))).))))....))))))))).....(((.(((..(((..((((.((((((..((((((((((((((((((....)).((((.....(((((((((.....((((((((((((.............((((((((((((((((((...((((((((...(((......(((((((((..((((((((((..((((.((((.(((....(((...((((((.......(((((...(((((.........((((((((((((((((.(((.((.(((((((((........(((((.((((.((.(((((((.....((((((...(((((((((....))))((((.((..((......((((((((....((((....((.((((((((((......((((((((.((((((..((((.((((((((....(((((....((((.((((.((((((..(((((((((((((....))).(((((......((((((...(((((.......)))))))))))...((((..((((.....)))).))))((((((..............))))))..)))))(((......)))..(((((((((........(..((((((((((((..((.((......)))).))))))))))))..))))))))))((.......)).))))))).)))....((((..((((((((..(((.((((.(.((((.(((((((.(((((((((((((((((((((((((.(((((((((((((..((....))..)).)))..))))))))))(((.((..((((.((..(((..((..((.(((((((((((((..((...(((...)))....)).)).)))))))).)))))..))..))).)).))))..))..)))..))))).))))))).)))))...........(((((.((((.(..((((((...((.(((((((...(((((((..((.((.....((((((((((((.(((((((((((...((((((((((((((.((((((((((.((.((((...)))).))...)))))))))).)))))))))))((((.(((((((((((..((.......)).))))))).)))).(((((((((((.(((........((((...(.(((((...))))).)...)))).))).)))))))))))))))..(((((.(((..(((((((..((.(((......))).)).)).)))))))).)))))........)))(((((((((((((((...(((.((((((.........(((......))).)))))).))).)))))))))))))))))))))))))).))))))))))))....)).)).)))))))))))))).))...))))))..).))))(((.((.((((..(((..((((.((...)).)))).(((((((....)))))))((.......))...))).)))).)).))).)))))........)))))).))).)))))))).)))))...))).))))))))..)))).(((((..((......))..(((...((((.((((.(((((....))))))))))))))))...)))))..............)))))).)))).)))).))))).))))))))....(((((((.....))))))).((..((((....((.(((.((((((..............(((.(((....))).)))..............)))))).))))).....))))..))......))))...))).)))...))))))))))).((((((((..((((((.((..(((....).))..)).))))))...................((((((..((((((.......((((((..............)))))).......))))))..))))))..((((........)))).)))).))))..((((......))))(((((((((((.....)))))))))))))))))).))))))....))))))))..))..)).))))(((((((.((((..((((...((((((..(((.....)))..))))))...).))).)))).)))))))))))).))))))....))))))).......(((((....))))).................(((((((......))))))).........)).))))..)))))......)))))).))).))...)))..))))))......((..((..((((.......))))..))..))..(((((..(((((.((((((.(..............(((((....)))))..((((....((((((((((((((......)))).......))))))))))..)))).....(((..((((((((((((((((...(((........))).))))))))))))))))..)))..).)))))..).))))).)))))...............))))))))))....(((((.((..(((.((((........)))).)))..)))))))...........)).)))...))))).....))))))..)))....))))))).))))(((....((((....))))....)))...))))).....)))))..)))))))))(((((....)))))...((((.(((...))).)))).....)))..))))))))....(((((........))))).(((((((...........(((((((......))))))).....(((((((.....((((((((((.....(((((....)))))(((((......((((((((..............))))))))....)))))((.(((...))).))))))))))))))))))).......)))))))((....)).))))))))).....))))).))))....((((.((((((......))))))...))))......)).)))))...)))))((((((((((..(((((........))))).))))).))))).))))).))))........).)))...(((((((((...)))))))))..)))))).)))))))..(((((((((......(((..(((.((....)))))..)))(((....)))(((((((((((((((...)))))))((((((.((.....(((((....))))).....))..))))))..((.(((..(((((((............)))))))))).))((((.(((((....(((................((((......))))........((((((....))))))......((((((((..((((......))))..)).))))))..)))....)))))))))........))))))))((((..((((.(((.(((....))).))).))))...))))...)))))))))......(((((...(((((...))))).)))))....)))....)))))).))))..)))..))).))))))))).))...((((.(((......))))))).........))).....
Thermodynamic Ensemble Prediction
....(((((((((((((........))).)))).))))))(({..((.(((((((((((.((((((((.(((,.....))).))))((((((((,({........)).)))).)))}....))))})))).....(((.((({{{((.,((((,{(((((,.{({(((((((((((((((,,,.,,.,|||,....(((((((({....,((((((((((((.............((((((((((((((((((.,.((((((((,.{(((,..{{{(((((((((..(((((,{(({..((((.((((.(((..{{({(,..((((((.......(((((...(((({.........((((((((((((((((.(((.((.(((((((((........(((((.((((.,,,((({{{{.....((((((...,,,,{{{{{....}}}}{(((,{({{({{{{,..({((((((,..,((((....((.((((((((((......((((((((.((((((..((((.((((((((....(((((....((((.((((.((((((..((((((((((,{(.,..|},..||{|||..,.(((((({,,{{({{.......}))}))))))).||((({..{(({.....)}}}.}}))((((((..............)))))),,}}},.,{({.{,,.|||,|{(({(((((....,,.{(,.((((((((((({..((.((......)))).))))))))))))..)))}}}}}}|((.......))})))||||.}}),,,.((((..((((((((..(((.((((.(.((((.(((((((.(((((((((((((((((((((((((.(((((((((((((..((....))..)).)))..))))))))))(((.((..((((.{{{.(((..((..((.(((((((((((((..((...(((...)))....)).)).)))))))),,))))..))..))).)).))))..))..)))..))))).))))))).)))))...........(((((.((((.(..((((((...((.(((((((...((((((,..((.((.....((((((((((((.(((((((((((..{((,(((((((((((.((((((((((.((.(((,...}))).))...)))))))))).)))))))))))((({.(((((((((((..((.......)).)))))))}}))).(((((((((((.(((........({{(.,,({((,,,,,}))))}.....}})).})),)))))))))))})))..(((((.(((..(((((((..((.(((......))).)).)).)))))))).)))))........)))(((((((((((((((...(({.((((((.........(((......))).}))))).))).)))))))))))))))))))))))))).))))))))))))....)).)).}))))))))))))).))...))))))..).))))((((((((((...(((........}.}))..,.))))))))))..{(((((((((........,,....)}.)))},)).)))})))))........)))))).))).)))))))).)))))...))).))))))))..)))).{{|{{.|||.||,.}}}..{{{.,.((((.((((.(((((....)))))}))))))),)).,,)))})..,,..........)))))).)))).)))).))))).))))))))....(((((((,...,))))))).((..((((....{{.(((.((((((.,,...,..{,{{.{((.(((....))).)))},...,,....}}.)))))).))),}.,...))))..))......))))...)))},))...))))))))))),((((((((..,,,{{{.{{..,((...,|{}|,.||,||||||,...................,||((,.{{{{{{.{|,...((((((,,......,...,.)))))).,..,,.)))))).,)}))))}})))),)}}}}.,,))..)))).))))..((((......))))(((((((((((.....)))))))))))))))))).}}||||,{{{|}}}}})),,}}..||,||}}{((((((.{(((..((({.,.((((((..(((,...,)))..))))))...).))).)))).))))))),,))}.))))))....})))))},|||,,.{(({{....})))),.,.,}},||,...,,.{{{((({,,,...)))))}}.,,.....,)},))))..)))))......)))))).))).))...)))..))))))..........((,.((((,,....,))))..}}..||..(((((..(((((.((((((.{,...,......,,.(((((....)))))..{{{{....((((((((((((((......))))..,..,.))))))))))..}})).....,,{..((((((((((((((((...(((........))).))))))))))))))))..,,,..,.)))),.}).))))).)))))..,............))))))))))....{((((,,...,{{.((({........))}}.}}}..,}}},,,...........}}.,)}...))))).....))))))..)),,,}.))))))).))))|,,....,{{,..,,||},.....,},,,},,,}},,..)))))..))))))))}(((((....)))))...{{{{.{{{..,))).}))),,.,.}}}..))))))))....(((((........))))),(((((((.........,,(((((((......))))))).....{(((({{...,{((((((((((....{(((((....)))))|{{(({{{...,|||||,,,..,.,,,,.,...,|{{,|{{{......)))).))}...,}),},)))))))))))))))))...,...)))))))|,....}).))))))))).....))))).))))....((((.((((({......))))))...})))......)).))))),..,))))|(((((((((..(((((........))))).))))).)))),.})))).)))),.........,,....(((((((({...})))))))).,)))))).)))))))..{((((((((.....,(((..(((.((....)))))..)))|((....))}((((((({{((((({...,)))))}((((((.((.....(((((....))))).....))..)))))),{{,.((.,.(((((((..,,....,}..))))))).},.)){(((.(((((....{{{,,,,...,,,,,.,,.{{({......,)))........((((((....))))))......,{{{{({{..((({......)))},.,,.,}}}},..))),...))))))))}........})))))))|(((,.((((.(((.(((....))).))).))))...)))}...))))))))}..,{,.{{(((,..{{{||,,.})))),))),),,},},}..}|))))}),)))).,)))..))}.}}})))))).}),..((((.(((......))))))).........,},.....

Transcripts

ID Sequence Length GC content
CAAACACUGCCUGGAGUGAGAGCAAACUACCAGCGCAGUGGGGCCGGCG… 3743 nt 0.4902
Summary

This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with ARNTL or compete for E-box binding sites in the promoter of PER1 and repress CLOCK/ARNTL's transactivation of PER1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. Defects in this gene are associated with the short sleep phenotype. [provided by RefSeq, Feb 2014]

Forensic Context

A study in mice demonstrated that the BHLHE41 mRNA was significantly upregulated in gastric tissues following 6 or 12 Gy X-ray irradiation, identifying it as a potential biomarker for radiation-induced gastric injury [Chen et al. DOI:10.1177/1559325819886766].