| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUUCUUGCUGCAGCAACGCGAGUGGGAGCACCAGGAUCUCGGGCUCGG… | 461 nt | 0.5336 |
Predicted to enable actin monomer binding activity. Predicted to be involved in regulation of cell migration. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the TMSB10 was identified as a gene expression marker with a potential key role in separating low- and high-functioning aged groups following laparotomy, showing differentially expressed patterns with reversed regulation between these groups [Asche-Godin et al. DOI:10.1093/gerona/glac043]. In a separate study in rats, the TMSB10 was listed among the top five differentially expressed genes upregulated in the spinal cord at 3 and 7 days following a tibial fracture [Deng et al. DOI:10.1038/s41598-025-17561-6].