Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACUCGGUGGUGGCCACUGCGCAGACCAGACUUCGCUCGUACUCGUGCG… | 622 nt | 0.4437 |
Summary
This gene encodes an actin sequestering protein which plays a role in regulation of actin polymerization. The protein is also involved in cell proliferation, migration, and differentiation. This gene escapes X inactivation and has a homolog on chromosome Y. [provided by RefSeq, Jul 2008] CIViC Summary for TMSB4X Gene
Forensic Context
A study in human corpus cavernosum tissue identified the TMSB4X as a spatially variable gene, with its expression upregulated in a region near the septum pectiniforme and cavernosal artery, while single-cell RNA sequencing showed it was widely expressed in endothelial cells, macrophages, and T cells at similar levels [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In a separate investigation using Sprague Dawley rats, RNA sequencing of the nucleus accumbens identified the TMSB4X as a gene of interest, though quantitative PCR validation found no significant differences in its expression as a function of maternal morphine exposure history in either the F1 or F2 generations [Vassoler et al. DOI:10.1016/j.neuropharm.2016.10.006].