Basic Information

Symbol
TMSB4X
RNA class
mRNA
Alias
Thymosin Beta 4 X-Linked TB4X TMSB4 Thymosin, Beta 4, X Chromosome Thymosin Beta-4 T Beta-4 Prothymosin Beta-4 PTMB4 THYB4 FX Fx
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_021109.4
Sequence length
622.0 nt
GC content
0.4437

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-164.10 kcal/mol
Thermodynamic ensemble
Free energy: -176.24 kcal/mol
Frequency: 0.0000
Diversity: 125.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((..((((((((((.((.((.....((.(((((.((....)).))((((.((((.(((((((((.(.((.(((((((.(......).))))))).)).)(((((.....))))).(((((...((...((((.(((....................))).))))...))...)))))....))))))))))))))))))))))....))..))))).))))))).....((((((.(.((((((...((((..(((((.((((((((((((((..(...(((((..(((((((((.((((.(((.(.((..((((.....)))))).).))).))))..))))...................((((...))))..((((((..((((((..((.....))..))))))...))))))...))))).))))).)..))))))))))))))))))).))))..)))))).))))))).......))))......(((((((((..(((...)))...))))....((((..((((..(((((((.............((((.((((((....)))))).))))))))..)))..))))..)))).......))))).....
Thermodynamic Ensemble Prediction
.((((.,((((((((((.(({,{{......,}.}||{(((,{.,{,.(((((.((((.(((((((((.{.((.(((((((.(......).))))))).)).}(((((,...,))))).(((((...((...((((.(((.{..............,,..))).))))...))...)))))....))))))))))))))))))...,}}.,)))}})))).))))))).....((((((.(.((((((...((((..(((({,((((((((((((((..{...{{{{(,,((((,{,{{,{{{{.(({,({,.{.((((.....))))}|.),}}).}}}}},}}}},..,.....,||,,,..,.((((...))))..((((((..((((((..((.....))..))))))...))))))..,}}}}},))))),)..))))))))))))))))))).))))..)))))).))))))).......)))).......,{{{((((..(((...))),..)))),...{(((..((((..{{{((({,,.,,........((((.,(((({....)}})}},))))))))..}}}..))))..)))).......,},,......

Transcripts

ID Sequence Length GC content
AACUCGGUGGUGGCCACUGCGCAGACCAGACUUCGCUCGUACUCGUGCG… 622 nt 0.4437
Summary

This gene encodes an actin sequestering protein which plays a role in regulation of actin polymerization. The protein is also involved in cell proliferation, migration, and differentiation. This gene escapes X inactivation and has a homolog on chromosome Y. [provided by RefSeq, Jul 2008] CIViC Summary for TMSB4X Gene

Forensic Context

A study in human corpus cavernosum tissue identified the TMSB4X as a spatially variable gene, with its expression upregulated in a region near the septum pectiniforme and cavernosal artery, while single-cell RNA sequencing showed it was widely expressed in endothelial cells, macrophages, and T cells at similar levels [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In a separate investigation using Sprague Dawley rats, RNA sequencing of the nucleus accumbens identified the TMSB4X as a gene of interest, though quantitative PCR validation found no significant differences in its expression as a function of maternal morphine exposure history in either the F1 or F2 generations [Vassoler et al. DOI:10.1016/j.neuropharm.2016.10.006].