| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCACAUUUCAGCCACUGCUCUGAGAAUUUGUGAGCAGCCCCUAACAG… | 1422 nt | 0.3664 |
The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]
A study in rats using single-cell transcriptomic analysis identified the TNFAIP6 as an orthologous gene associated with inflammatory processes in radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357]. In human skin, a microarray analysis of thermal injury demonstrated that the TNFAIP6 was significantly upregulated in burned tissue during the early wound repair process [Greco et al. DOI:10.1016/j.burns.2009.06.211].