| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCAGUGCAGCUGUGGGAACCUCUCCACGCGCACGAACUCAGCCAACGA… | 1395 nt | 0.5699 |
The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain and a transmembrane domain, but no cytoplasmic death domain. This receptor is not capable of inducing apoptosis, and is thought to function as an antagonistic receptor that protects cells from TRAIL-induced apoptosis. This gene was found to be a p53-regulated DNA damage-inducible gene. The expression of this gene was detected in many normal tissues but not in most cancer cell lines, which may explain the specific sensitivity of cancer cells to the apoptosis-inducing activity of TRAIL. [provided by RefSeq, Jul 2008]
A study in human epidermal keratinocytes demonstrated that the TNFRSF10C was upregulated 1.65-fold at 3 hours following a cytotoxic 5 Gy X-ray irradiation, identifying it as part of the transcriptional response to ionizing radiation-induced skin injury [Koike et al. DOI:10.1269/jrr.46.173]. In a separate investigation of thermally injured human skin, the TNFRSF10C was found to be significantly up-regulated in burned tissue compared to normal skin, classifying it within the inflammatory and immune response gene category during the early wound repair process [Greco et al. DOI:10.1016/j.burns.2009.06.211].