| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGUAGCUGCGAGAACCUUUGCACGCGCACAAACUACGGGGACGAUUU… | 3535 nt | 0.4707 |
The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain, a transmembrane domain, and a truncated cytoplamic death domain. This receptor does not induce apoptosis, and has been shown to play an inhibitory role in TRAIL-induced cell apoptosis. [provided by RefSeq, Jul 2008]
A study in human skin demonstrated that the TNFRSF10D is significantly up-regulated in thermally injured tissue compared to normal skin during the early wound repair process, as part of an extensive temporal gene expression profile involving 2,286 altered genes [Greco et al. DOI:10.1016/j.burns.2009.06.211].