Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGACGCACCGGAGCGCUCGCCCAGCCGCCGCCUCCAAGCCCCUGAGG… | 2087 nt | 0.3991 |
Summary
The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Forensic Context
A study in human and rat skin demonstrated that ultraviolet-B irradiation induces significant transcriptional changes, with the TNFRSF11B being up-regulated in both species (fold change 22.1 in human and 4.7 in rat) at the peak of hyperalgesia [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate forensic investigation of human cadaver liver tissues, the TNFRSF11B was identified as a death domain protein and was found to be down-regulated more than threefold (-3.759 fold) in decaying tissues compared to a control, contributing to the apoptotic thanatotranscriptome profile associated with the postmortem interval [Javan et al. DOI:10.1007/S12024-015-9704-6].