Basic Information

Symbol
TNFRSF12A
RNA class
mRNA
Alias
TNF Receptor Superfamily Member 12A TweakR FN14 CD266 Fibroblast Growth Factor-Inducible Immediate-Early Response Protein 14 Tumor Necrosis Factor Receptor Superfamily Member 12A FGF-Inducible 14 Tweak-Receptor Tumor Necrosis Factor Receptor Superfamily, Member 12A Type I Transmembrane Protein Fn14 CD266 Antigen
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Mechanical injury analysis

MANE select

Transcript ID
NM_016639.3
Sequence length
977.0 nt
GC content
0.6264

Transcripts

ID Sequence Length GC content
GCAGACAGCGGCGGGCGCAGGACGUGCACUAUGGCUCGGGGCUCGCUGC… 977 nt 0.6264
Summary

Involved in positive regulation of extrinsic apoptotic signaling pathway and regulation of wound healing. Predicted to be located in cell surface and ruffle. Predicted to be active in plasma membrane. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in humans and rats demonstrated that ultraviolet-B irradiation induces significant transcriptional changes in skin, with the TNFRSF12A being up-regulated in both species (fold change 11.6 in human and 4.5 in rat skin) [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate human postmortem brain study, the TNFRSF12A showed lower expression in the dorsolateral prefrontal cortex of individuals with major depressive disorder and suicide compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130]. A study in humans demonstrated that severe burn injury significantly upregulates gene expression of inflammation and proteolysis regulators in non-burned skeletal muscle, where the TNFRSF12A (TWEAK receptor Fn14) exhibited a 6.0-fold higher mRNA expression in burn patients compared to matched controls [Merritt et al. DOI:10.1097/BCR.0b013e31827a2a9c]. This elevation, alongside increased atrogin-1, MuRF1, and other cytokines, indicates a systemic molecular response driving muscle atrophy in tissues distant from the injury site.