| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGACAGCGGCGGGCGCAGGACGUGCACUAUGGCUCGGGGCUCGCUGC… | 977 nt | 0.6264 |
Involved in positive regulation of extrinsic apoptotic signaling pathway and regulation of wound healing. Predicted to be located in cell surface and ruffle. Predicted to be active in plasma membrane. [provided by Alliance of Genome Resources, Apr 2025]
A study in humans and rats demonstrated that ultraviolet-B irradiation induces significant transcriptional changes in skin, with the TNFRSF12A being up-regulated in both species (fold change 11.6 in human and 4.5 in rat skin) [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate human postmortem brain study, the TNFRSF12A showed lower expression in the dorsolateral prefrontal cortex of individuals with major depressive disorder and suicide compared to non-psychiatric controls [Pantazatos et al. DOI:10.1038/mp.2016.130]. A study in humans demonstrated that severe burn injury significantly upregulates gene expression of inflammation and proteolysis regulators in non-burned skeletal muscle, where the TNFRSF12A (TWEAK receptor Fn14) exhibited a 6.0-fold higher mRNA expression in burn patients compared to matched controls [Merritt et al. DOI:10.1097/BCR.0b013e31827a2a9c]. This elevation, alongside increased atrogin-1, MuRF1, and other cytokines, indicates a systemic molecular response driving muscle atrophy in tissues distant from the injury site.