| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGUUCUCAACAUUCUAGCUGCUCUUGCUGCAUUUGCUCUGGAAUUCU… | 891 nt | 0.4153 |
The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008] CIViC Summary for TNFRSF17 Gene
A study in human trauma patients demonstrated that TNFRSF17 mRNA was significantly downregulated in circulating CD3+ T cells during the injury stage compared to the recovery stage [Rau et al. DOI:10.2147/JIR.S375881].