Basic Information

Symbol
TNFRSF1B
RNA class
mRNA
Alias
TNF Receptor Superfamily Member 1B TNFBR P75 TNF-R-II TNF-R75 TNFR80 CD120b TNFR2 Tumor Necrosis Factor Receptor Superfamily Member 1B Tumor Necrosis Factor Receptor Type II Tumor Necrosis Factor Receptor 2 P80 TNF-Alpha Receptor TNF-RII TNF-R2 Tumor Necrosis Factor Receptor Superfamily, Member 1B Tumor Necrosis Factor Binding Protein 2 Tumor Necrosis Factor Beta Receptor P75 TNF Receptor CD120b Antigen Etanercept P75TNFR TNFR-II TNFR1B TBPII
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_001066.3
Sequence length
3687.0 nt
GC content
0.5951

Transcripts

ID Sequence Length GC content
AGUCGAGGGCUAGCGAGCGCAGCGGAGCCUGGAGAGAAGGCGCUGGGCU… 3687 nt 0.5951
Summary

The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. The function of IAPs in TNF-receptor signalling is unknown, however, c-IAP1 is thought to potentiate TNF-induced apoptosis by the ubiquitination and degradation of TNF-receptor-associated factor 2, which mediates anti-apoptotic signals. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. [provided by RefSeq, Jul 2008]

Forensic Context

A meta-analysis in humans identified the TNFRSF1B as a key hub protein in a neurodegeneration-associated interaction network linked to post-mild traumatic brain injury signaling, where its deficiency leads to poorer TBI outcome [Matyasova et al. DOI:10.4149/gpb_2021038]. A separate single-cell transcriptomic study in a rat model of radiation-induced lung injury identified the orthologous rat gene Tnfrsf1b as associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357]. A study in mice demonstrated that tumor necrosis factor receptor 2 (TNFR2) was upregulated after a cutaneous burn injury, with expression peaking at 3 days post-injury [Feezor et al. DOI:10.1152/physiolgenomics.00101.2003]. In a separate cryolesion brain injury model in mice, the absence of TNFR2 did not significantly decrease the inflammatory response or tissue damage, in contrast to the pronounced protective effects observed with TNFR1 deficiency [Quintana et al. DOI:10.1002/jnr.20680].