| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCCUCGCCGACCAGUCUGGGCAGCGGAGGAGGGUGGUUGGCAGUGG… | 3595 nt | 0.5093 |
This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
A study in human prostate tissues demonstrated that the TNFRSF21 was significantly upregulated at longer postmortem intervals (96 h and 120 h) compared to a 24 h control, as validated by PCR array analysis and statistical testing [Tolbert et al. DOI:10.1016/j.gene.2018.06.090].