Basic Information

Symbol
TNFRSF21
RNA class
mRNA
Alias
TNF Receptor Superfamily Member 21 DR6 Death Receptor 6 CD358 Tumor Necrosis Factor Receptor Superfamily Member 21 Tumor Necrosis Factor Receptor Superfamily, Member 21 TNFR-Related Death Receptor 6 CD358 Antigen BM-018
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_014452.5
Sequence length
3595.0 nt
GC content
0.5093

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1180.97 kcal/mol
Thermodynamic ensemble
Free energy: -1250.33 kcal/mol
Frequency: 0.0000
Diversity: 1147.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((..(((((((((..(((((((((((((((((.(((.(((((.((..(((((((((.(...).)))))..))))...(((((...((((.(((((((........(((((((((.((....))..)))))))))....(((((.((..(((((....))))).)).)))))..(((..((((((...)))))).)))))).)))).))))....)))))..)).)))))))).)))))))))))......(((((((((....(((((((((((((((((..((((.(((((..((.(.((.(((((((((..((((((((........))).)))))..)))).))))))).).))..))))).))))))))(((((((((((...)))..))))).)))(((((((((.((....((....))....(((....)))..((((((.((..(((......).)).))))))))......)).)))))))))))))..)))))).)))........(((((((((.....(((((((((.....(((((((((((........(((......))).(((((....))))).((((((..(((....)))..)).)))).....(((((......((((.((...(((((((((.((.((.((((((((((.........)))((((((((.(((((((......)))))))(((....))).(((((....)))))...(((((....))))).))))))))..((((......))))...((((((((.((((..((((((((((((((..(.((..((((((.((((((((((......)))))...))))).)))))).....)).)....)))))).))))))))))))...)))).)))).))))))).)).)))))))))))...)).)))).....)))))...((((((((((((..((((...))))..(((((((((((..(((.((((((...((((((((((...))))))......)))).))))....)).))).(((.((.((((((((((((...))).............((((((.(((((....)))))..((((((((((....(((((((......)))))))...............((((...(((((.((......)).)))))..)))).......)))))))))).(((...))).......))))))...)))))))))..)).)))................(((....))).))).))))))))...((...))..((((.(((((((((.((((.(((.((.((..(((.((((..((((((((.(........).))))).)))..))))))).)).)).).(((..((((((((.......((((((.....((((...(.((....)))...))))...)))))).((((((((((((...(((.(((((((.(((.(((((((((((.....(((((((((...(((.....((((((((((..((...(((((((.............(((((((((.....((((((..((((............))))..)))))).......(((((.((...(((((..((((((.....(((.(..((..(((....)))..)))))).....)))))))))))...)).)))))..(((.((..(.((..(((((.(((((........)))))..)))))..)).)..)).))).....))))))))).))))))).))..)))))))))).....))))))))...)))).........(((((..((((..((((((..((.((.((((((((((.(((((((((((((((.............(((((..............((((.......)))).)))))..((((.....)))).)))))...)))))....))))).)))((((((((((((((((..((((.((((((((((.....))).........))))))).))))))).))).)))))....)))))........)))))))..)).))..).))))).)))).)))))...(..((((((.((........)).))))))..).((.(((((((((((..((((((....((((.....))))....((((((((.((..(((((....((........))))))).....)).))))))))......))))))..((((......(((..((((((((.((....)).))....((((((((((..............)))))).))))....)))))).))))))).))))))))))).))....))))))))))).)))..)))))))))).))))))))))))................))))))))..)))....)).))))))))))))).)))).))))))))))))))).))))))))(((.(((.((((...((((((...((.((((.((.(((((.......((..((((((...............................))))))..))....)))))))..)))).))....))))))....)))).))))))..((((...((((((((.....((((((((....((((......((((..(((((..((((((..((((...............(((((....(((.(((((((..........))))))).))))))))(((.(((((((.....)))).))).)))....(((((((....((((.((.(.....).))))))..)))))))............((((((.((.((..........)).))))))))((((....(((((((((((((...))))))))))))).....((((.((((.......((((((..((..((((((......))))))..))..)))))).......)))))))).((((....(((((.((...........)).)))))))))...))))...)))))))))))))))......)))).........((......))...))))))))))))........(((((((((..((((.....))))..)))))))))....(((....)))..)))))))))))).........))))))))))))))))))....))))))))).((.(((((((..........(((((...))))).))))))).))......))))))((((((.......((((..((((((..((((......))))..))))))....)))).....)))))).))))))..))))))))((((((((((.((((((.........((((.(((((.(((((((.......)))..)))).))))).))))((.(((((((((...((.((((..((((.....))))..))))..))..(((((((.((......)).))))))))))))))))))....))))))))))))))))............((((((((...(((((................)))))))))))))....
Thermodynamic Ensemble Prediction
.(({,.,,{,,|||({(,({((((((((((((((((,(({,(((((.(({,(((((((((.{...}.))))}..))))...(({,,...||{{|((({||,,{|||..{(((((((((.{{.,..}}.,)}))))}|}.{,,||}|.{(((((({((,,{{({(({{({,,|,,||}|||{,||||||,.,))}))))))).)),|||,,|||||...,,}||.,||.||||||||,|||}|||||||,,.|,.{{{|,{{|||...{{||||{{,|||||{,{..((((...,||||||||,||||||||{|||.,|||||||{,,,,,,.,)})}}))))..)})}})})))}},)}},.,))))),||,,||||(((((((((((...)))..)))))},)).,,,,||}|,.)),,,))}}}}})))))|||,}},}},..((((({{((..{{{......}.}}.))))))))....,((((,{((((((.......{{,,((.(((({(,,((({(((,.,{{,{(({,,{{...,,{{,((((.,,,...||||||,{|{{{{,{{{...||,{((((....}}|||.(((,,{.|||{.|,|)),.}}}.}})},}}}.||,{({{.....,}}}}||((((({...,)),)}}),}},.})))}}))..}}...))})))),)}|,{((((((......))))))}{{{....)))}{{{{|,...))))),,,||||{|||.|,,||,||||.||}},||{|}}},.,||||...{(((,{((,((((..((((((((((((((..(,((,,(({(((,(((((((,((.....})))))},.,}))),}})))}.,|..})|}....))))}).)))))}))))))...)))}}))}),)))||||{.|||,,,}}.)})))}},,.(((({.,,..{{{|...)))).|(((((({{((((..{{.,..{(((((,|,,..,.,))}))),,....,))..}})))}..)))))))})}}})),}.||{{{{{,{{{||||{((,,{{({{{{((({{(({{,|,,.....{{{{{{{{((,,((,(((((....)))))..((((((((((....(((((({......}))))))..,,..,{{{,....,,,,,,,||(({.((.....,)}.}))),.,)))).,.....)))))))))).{,,{{{|,|{{{...,||{(((((((((((||((.....,,........,}})})}....({{((((((((({.((((((((((((((..,{{((((.(((((((((,((((.{{,.((.((..(((.((((..((((((((.{........).))))).)))..))))))).)).)).|,(((..((((((((,,.,,..((((((.....((((...(.((....))}...))))...))))))..(((((((((((...(((.(((((((.{((.(((((((((((.....(((((((((...(((.....((((((((((..((.,.(((((((..{{((((....(((.((((((.{{,.{(((((..((((............))))..)))))),}....(((((,.(({,,.((({....|||),},..}}}}))))))))))..,,{({{{{|.,{{({{..,,.,)))))..))}))}}}})..,{((,,({.(((({((,,...,,))))))),..}})}}}..,,)))..))))}}(({|||.....,,))})))).))))))),))..)))))))))).....))))))))...))))......|,.(((((..((((..(((((,..{{.{{.{(((((((((.((((((((((({(((.............(((((..............((((.......)))).}))))..((({.....)))).})})}..})))))....))))).))},,{,,{{{{((({(((..,,{|.{|||{{||||,|,||)}}..,{,,...|||||||.||},,,,.))).,))))}}}.))))||{|||,|,}}}}}}}.,)),)),.}.))))).)))).)))))..,|{,((((((.{(........}}.))))))..}.(({(((((((((((..((((((....((((.,,,{||||,...(((({(((.{{..({{{{....,,........))))))),,,,,)).))}}}})}......))))))..((((......(((..(((((({{.{,....,}.}}....((((((((((.,............)))))).))))....}))))).))))))).)))))))))),.))}}..))))))))))).))}..)))))))))).)))))))))))),}},............,)))))))..))}....)).))))))))))))).))))}),|{{||{({((((((((({((((((({(,({(,(((((((((((...{,.((((.((.(((((.,.....,{..((((((..........,{,.....}}}..........))))))..))....)))))}),.)))).,}....)))))}..,})))).))))))..{{({,.,{(((((((.....{(((((((....((((......(((,..(((((..{(((({,,(({{.........,,.||,(((({,,,.(((.(((((((..........))))))).))))))}}({{.{({{{{{...,,}))).}||,||}..,,(((((((....{(((.((.{.....).))))))..)))))))............,.(((((((.{(..........,}.)).))))))}...,,.(((((((((((({...})))))))))))),},..|||,|||||,|,.|,,{(((((..((..((((((......))))))..))..)))))},}..,,.}}||},||.{(((,...{((((.((.,,,...,,,.)).)))))))))}}.))),...))))))))))))))).,,,..}}}..........((......))...)))))))))))).,......(((((((((..((((.....))))..)))))))))....(((....)))..)))))))))}}}....,{{(((({{..,,,,,)))))))}}}}))},|||})||,.(((((((..........(((((...))))).))))))}.||||{,,.,},,|||{{{{,.....}}||,|}.,..}}}}}}})})))))))))}.,}.|{({,...})))}.......)))))))...)))))))|{.,.,,}}.,,,,{{,...,.,.......}))}}}|..}}).}}}..}))))).)))}||{{{||(||.,,||{,...|||,|,|}}}})}}.........))}..)))).})))..,...})),.,)).))))))))......,)))))})),)))),..))))))}}))),))))))).,......,...{{|||||.,.,||||,,,.......{{{{{{||||.,,))))))})),

Transcripts

ID Sequence Length GC content
AGUCCCUCGCCGACCAGUCUGGGCAGCGGAGGAGGGUGGUUGGCAGUGG… 3595 nt 0.5093
Summary

This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]

Forensic Context

A study in human prostate tissues demonstrated that the TNFRSF21 was significantly upregulated at longer postmortem intervals (96 h and 120 h) compared to a 24 h control, as validated by PCR array analysis and statistical testing [Tolbert et al. DOI:10.1016/j.gene.2018.06.090].