Basic Information

Symbol
TNFRSF9
RNA class
mRNA
Alias
TNF Receptor Superfamily Member 9 CD137 4-1BB ILA Tumor Necrosis Factor Receptor Superfamily Member 9 T-Cell Antigen 4-1BB Homolog 4-1BB Ligand Receptor CD137 Antigen CDw137 Interleukin-Activated Receptor, Homolog Of Mouse Ly63 Tumor Necrosis Factor Receptor Superfamily, Member 9 Induced By Lymphocyte Activation (ILA) Homolog Of Mouse 4-1BB Receptor Protein 4-1BB T Cell Antigen ILA T-Cell Antigen ILA IMD109
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001561.6
Sequence length
5872.0 nt
GC content
0.4343

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2161.10 kcal/mol
Thermodynamic ensemble
Free energy: -2259.87 kcal/mol
Frequency: 0.0000
Diversity: 958.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((((....(((.....))).(((((((((((((((((((.(((.((.......(((..(((((.((.(((.((.((((((..((.....))..)))))).)).))).)).)))))..)))(((((((((((((..(((((.(((..(((((......)))))(((((((((((((((....(((((((.(((((((.....((((((((...)))))))).(((((....(((((...((((((.......)))))))))))....)))))...))))))))))..))))..((((.(...).))))....((.((((.(((((.((((.....))))...)))))..)))).)).(((.(((....)))))))))))))..))))))))...((((.(((((((.........)))))))))))(((((..(((((........((((((.......((((.....))))........(((.(((((.(....)))))).))).....))))))....))))))))))((((.......))))..))))))))..))))))..))))).))((((.......)))).(((((((((.((((((....)))))).)))..((...(((((((((((.(((......(((....))).))).)))).)))))))...))...))))))((((.(((((((((((((.(((...((((.((((...(((((((.......(((((.(((((((..(((((((((..(....)..)))))))))........((....)).....................((((...(((....))).)))).)))))))))))).))))).)))))).).)))...))))))))))))...)))).))))......)).)))..))))))))))))...(((((((........))))))).....(((((((((((.(((((((((((.......(((.....(((((((.......((((((.....((((.(((..((((((((((((.(((((....))))).))))..............(((((((((((..((((((((.((.((((((((((((((((((((((((((((.((...(.((((((.((((((((((..((((((((...(((((((((.((((.(((((((((((((((((((((((...((((.((....(((((((..(((((((((..(((((((.((((..((((((.((((((..(((((((((((((..(((((((.((((((((((((..((((.(.((((((((((((((((((((((((((((.(.(((.(((((..(((.((((....(((.((((........((((...(((((((((((((((((((.((.((................((((((......((((((((...(((((((((((((((((((((((........))))))))..)))))))))......(((((((((((((((.(((((.((((.((....((((((((((((((.(((((((.(((((.....(((((.((((((((..((.(((((.(((((.....))))).(((....)))..))))).)).)))))))).......((((((((.((......))))))))))...((((((((((.((((((((...(((((((........((((..(((((......((((((((.(....((((....)))).....).)))).))))........))))).)))))))))))...))))...))))))))...))))))............................))))).....))))).))))))))))))).)))).(((....((.((((((((...((........))...)))))))).)))))...(((((((.((...(((((...........)))))..)))))))))....))))....)).))))..))))).)))).)).))).......(((((((((((((((((((.((.(((((((((((..((.....((((((((.(((((.(((((.........))))).))))).......(((((.....(((((......)))))....)))))(((((.(((((....)))))..))))))).))))))))..)))))))..............................((((((...)))))).(((((((((((((((.((((((....))))......(((((((................)))))))....((...(((((.((.(((((((((((((.(((((...((((((((((((((((((((((((.(((((((.((((((((((((((((.((((((((((.(((((((((((.((((((((..((((((((((((((((((((..(((((((((((.((((((((((((((((((((((((..(((((((((...((.((((....)))).))..........((((((......((((..((((((.((......))..))))))..))))(((((((((((((....(((((((((((.(((((...))))).))))(((((((.((.((((.((((((((((.....((((((..........))))))....((((..(((......))).....))))((((((.......)))))))))))))))))))).)))))))))..................(((((.....))))).)))))))..)))))))))......))))........(((((((((..((((((((((....(((((............((((....)))).....((((((.(........(((((((.((((....((((.(((((((.......))))))).)))))))).))))))).......).)))))).)))))))))))))))..)))))))))((((((....))))))...))))))(((.(.((((((((......)))))))).).))))))))))))..)))))))))))))))))))))))).)))))))))))..))))))))))))))))))))..)))))))).))))))))))).)))))))))).)))))))))))))))).))))))).))))))))))))))))))))))))...))))).))))))))))))).)).))))).)).)).)))))))))))))))((((.(((....))).))))....)))).)).)))))))))))))))))))....(((((((.((((..((((((((.(((....).)))))))))).)))).....)))))))...))))))....((((....)))).((((((.......(((((....)))))........))))))(((.((((.(((((...(((((((.(((((((((((.((((((((((((((.(((((((.((((.(((.(((((((((((((((((((.(((((.(((((((((.......(((.......))).......((((((((......(((....)))......))))))))...((((((((..(((((((...((((((..(((((((((((((.(((.(((((.......).))))))).)))).))))....))))).....))))))..)))))))....................((((...((((((((....))))))))....)))).........(((((((((((((......((((((.....))))))......)))))).))))).)))))))))).))))))))).))))).))))))))))))))))))).))).)))).))))))).)))))))))))))).))))))))))).)))))))...))))).)))).)))...)))))).............)))))))).....)).)))).((((..((((.((((((((..((((.(((..((((((......)))))).....))).))))..))).))))).))))....)))).(((((....)))))(((((..........(((((..(((((..........(((((........))))).......((((((...........))))))..(((((((((.((.((.((((.((((((((....(((.((.(.((((((.(((((..(((...))).)))))((.((((((...)))))).))........)))))).))).))).))).))))).)))).)).))...)).))))))))))))..)))))))))))))).))))))))).....)).))))))))...))))((((((.....)))).))...((((((.....))))))...............(((.(((........))))))......((((.....)))))))).)))....)))).)))..))))).))).).)))))))))))))))))))))))))))).).)))).((((......))))))))).))))))))))))))..)))))))))))))..)))))).)))))))))).))))))))))))))))..))))))).....))))))...))))))))))))))))))))))).)))).))))))))).))))))))...)))))))))).)))))).)...)).)))))))))))))))))))))))))))).)).))))))))..))))))))))))))))))).))).))))....))))))...(((((........)))))....((((.((((.((((...((((((((..(((((((((((((((((((...((((.(((((((.((((((((........((((((((((((.....((((((...........).))))).....)))))...)))))))((((........)))).......((((((........)))).))...(((((((((((((.((........)).))))))..)))))))((((.(((((..(((((((...(((....(((((..((((((.((((((((((((..((.(((.(....).))).))..)))..............(((..((((((((......))))))))))).......(((((...)))))))))))))).)))))).............(((((......))))).....)))))(((.(((.(((((((((((((((((((....)))))))).....))).)))))))).)))..))).............))).))))))))))))))))))))..)))).))))))))))).......((((..(((.((((............)))).))))))).))))))))))...).))))))))...)))))))).((((((((........)))))))).............((((((..((((((((...................))))))))))))))...)))).)))).))))....(((((((((.......)))))))))...))))..))).....)))....)))))).....)))))..))))))))))).......(((((((((.(((((((((..((....))..)))))))).).)))))))))((((((..(((((((.((...)).)))))))..)))))))))))))(((((....)))))......((((((.....))))))..........((((((......)).))))..)))).......................
Thermodynamic Ensemble Prediction
.......((((...,({{.,..,|||,{((((({((((((((((((.(((.((.,,{{{,(((..(((((.((.(((.,{.((((((..{{.....})..)))))).},.))).)).)))))..)))(((((((((((((..((({{{(((..(((((......)))))(((((((((((((((.,,..,,{{{{.(((((((.{...((((((((...)))))))).(((((....(((((...((((((.......)))))))))))....)))))...)))))))}}},.,}||..{{{{.{...}}}))).,..((.((((.(((((.((((.....))))...)))))..)))).)).((,,(((....)))))))))))))..))))))))...((((.(((((((,,......,)))))))))))(((((..(((((.....,..((((((.......((((.....)))).....,..(((.(((((.(....)))))).))).,}}.))))))....)))))))))){(((.,...,.)))}..))))))))..)))))}..))))).))((((.......)))).(((((((((.((((((....)))))).))).,((...(((((((((((.(((......{{{....})}.))).)))).)))))))...)).},))))}|((((.(((((((((((((((((...((({.((((...(((,,(({......((((,{(((((((..(((((((((..(....)..))))))))).,......,,...,||......,,.............((((...(((....))).)))).))))))))}))).},))).)))))).},)))...))))))))))))}..)))).))))}.....)).)))..))))))))))))},,|((((((........)))))},.,,,.(((((((((((.((((((((({{..}|}|.,{{,.....,,,..........((((((.....((((.{((..((((((((((((.(((({....})))).)))}.............,{((((((((((,.((((((((.((.((((((((((((((((((((((((((((.((...(.((((((.((((((((((..((((((((...(((((((((.((((.(((((((((((((((((((((((...((({,((....(((((((..(((((((((..(((((((.{((,.{((((((.((((((..(((((((((((((..((((((,{((((((((((((.,((((,(.((((((((((((((((((((((((((((.(.(((.(((((..(((.((((....(((.((((........((((...(((((((((((((((((((.((.((................{{{(((......((((((((.,,(((((((((((((((((((((((,.....,,))))))))..}))))))))......{((({{((({(((({.(((((.{{{{.,{....{{{,((((((((({{(((((((.(((((.....{((({.((((((((..((.(((((.(((((.....))))).{({....}}}..))))).)).)))))))).......((((((((.((.....,)}))))))))...((((((((((.((((((((...(((((((,.......((((..(((((..,...(((({(((,,..,,(,{,....|,,,..,.,),}))).))))}}}.,.,.))))).)))))))))))...)))}..,))))))))...))))))...............,............))))}.....))))).))))))))))))).)))).((({.,.,{.((((((((...((........))...)))))))),}))))...(((((((.((...(((({...........}))))..)))))))))....}}})..,.}),}))}..))))).,}))},}.))).......(((((((((((((((((((.((.{((((((((((..(({....{(((((((.(((((.(((((.........))))).))))).......(((((..,,.(((((......)))))...,)))))(((((.(((((....)))))..)))))))},)))))))..))))))).......,......................((((((...)))))),(((((((((((((((,((((,(,{.{||,}......((({{{{...............,)}}}}}}...,|,...{((((.((.(((((((((((((.(((((.,,{(((((((((((((((((((((((.(((((((.((((((((((((((((.((((((((((.(((((((((((.((((((((..((((((((((((((((((((..(((((((((((.((((((((((((((((((((((((..{((((((((...,,.,((({,..||||{||{.,{,.....(({,,,.}|}|.((((..((((((.((......))..))))))..))))(((((((((((((.,,.{((((({((({.(((((...})))).})))(((((((.((.((((.((((((((((.,{,.((((((..........)))))).,,}((((..(((......))).....})))((((((.......)))))))))))))))))))).)}))))))}...........|,,....(((((.....))))).}))))))}.)))))))))......)))).,.,,)}}}}|||||||}.{(((((((((....{{(({....,....}|.((((....)))).....((((((,,,,......(((((((.((((.{..{,,,.(((((((.......))))))).}}),)))).)))))))...,,}.).)))))).))))}))))))))))..|||||}||{((({{,...,))))))})))},,}|,{{.|,((((((((......)))))))).,.}},))))))))}..)))))))))))))))))))))))).)))))))))))..))))))))))))))))))))..)))))))).))))))))))).)))))))))).)))))))))))))))).))))))).)))))))))))))))))))))))},,.))))).))))))))))))).)).))))).)),)).)))))))))))))))|(((.(((....))).)))}....)))}.)).))))))))))))))))))).,,.(((((((.((((..((((((({{(((....}.)))))))))).)))).....)))))))..,}}}}}}....{(({....)))).((((((.......(((((....)))))........))))))(((.((((.(((((...(((((((.(((((((((((.((((((((((((((.(((((((.((((.(((.(((((((((((((((((((.(((((.(((((((((.{{,,,,(,(.......}}}.......((((((((..,,..(((....)))..,,..))))))))...{((((({,..(((((((...((((((..(((((((((((((.(({.(((((.......).))))))).)))).))))....))))).....))))))..)))))))....................,{,,..{(((((({,...}))))))),..,,}}|,........,{{(((({{(((((......((((((.....))))))....,.}))))).))))).)}))},,}}).))))))))).))))).))))))))))))))))))).))).)))).))))))).)))))))))))))).))))))))))).)))))))...))))).)))).)))...)))))}...........,,)))))))).....)),}}}},.((({..{((.((((((((..((((.(((..{(((((......)))))}.....))).))))..))).))))).)))))).}}....(((((....)))))((((,.........{(((((..(((((..........(((((.,....,.))))).......((((((...{....}..))))))..((((((({(.((.((.((((.((((((((....{({.((.(.((((((.(((((..(((...))).)))))((.((((((...)))))).)}........)))))).))).))}.)))}})))).)))).)).)}...)).))))))))))))..)))))))))))))).)))))))))}....)).,)))))))...)))){{((((.....)))).||...{(((((.....)))))).}},....||,.,..((,.(({.....,,.,)),,,......,{{{.....)))))))).)))..,.)))).)))..))))).))).).)))))))))))))))))))))))))))).}.))}),{{{{.,,...)))}))))))))))))))))))))..)))))))))))))..)))))).)))))))))).))))))))))))))))..))))))).....)))))).,.))))))))))))))))))))))).)))).))))))))).))))))))...)))))))))).)))))).)...)).)))))))))))))))))))))))))))).)).))))))))..))))))))))))))))))}.))).))))....)))))),,,{{{{{,,,.....}}}},....,||{.(({{{((({,,,||||||||..((((((((((((((((((,...((({,(((((((.((((((((........((((((((((((.....((((({...........}.))))).....)))))...))))))}((((........))))|,{{...||||{{...,,...}}}}}))...(((((((((((((.{{........)}.})))))..)))))))((((.(((((..(((((((...(((.(((({(((,,((((((.(((((((((({(......}}}|....,,{({{{{,,,.......,...}.},.|}|}}{(((((((......)))))))}|||......,|||||.,,)))))))))))))).})))},....,,.......(((((......))))).,,..})))|(((.(((.(((((((((((((((((((....)))))))).....))),}))))))).)))..))),......}}}},.))).))))))))))))))))))))..)))).))))))))))).......{(((..(((.((((............)))).))))))),))))))))))...)}))))))))...,||,,|||,((((((((........))))))))..,},,.......{(((({..((((((((...................)))))))))))))}........|}}||}}}||||||{(((((({.......,,})))))},,,{|||,,,,..,}}}}}}}}.,))}})),....)))))..))))))))))),,,...,(((((((((,{((((((((..((....))..}))))))).).)))))))))|(((((..(((((((.((...)).)))))))..)))))},}||}}|(((((....))))}|,|,..((((({.,,..,,|||,..,,,..,,,|,,,,,..,}..}}.})))..)))).......................

Transcripts

ID Sequence Length GC content
GCAGAAGCCUGAAGACCAAGGAGUGGAAAGUUCUCCGGCAGCCCUGAGA… 5872 nt 0.4343
Summary

The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the TNFRSF9 transcript increased within 1 hour postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267]. Research in human prostate tissue from cadavers found that the TNFRSF9 gene, a pro-apoptotic factor, was significantly upregulated at postmortem intervals of 96 and 120 hours compared to a 24-hour control [Tolbert et al. DOI:10.1016/j.gene.2018.06.090]. A study in mice demonstrated that acute cold exposure (4°C for 4 hours) induced beige adipocyte formation in subcutaneous white adipose tissue, with RNA-sequencing revealing 714 differentially expressed genes [Liang et al. DOI:10.3390/ijms20163968].