Basic Information

Symbol
TNFSF11
RNA class
mRNA
Alias
TNF Superfamily Member 11 TRANCE RANKL OPGL ODF CD254 Tumor Necrosis Factor (Ligand) Superfamily, Member 11 Tumor Necrosis Factor Ligand Superfamily Member 11 TNF-Related Activation-Induced Cytokine Osteoclast Differentiation Factor Osteoprotegerin Ligand Receptor Activator Of Nuclear Factor Kappa B Ligand Receptor Activator Of Nuclear Factor Kappa-B Ligand Tumor Necrosis Factor Superfamily Member 11 Tumor Necrosis Factor Ligand 6B CD254 Antigen HRANKL2 TNLG6B OPTB2 SOdf
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003701.4
Sequence length
2201.0 nt
GC content
0.4330

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-641.60 kcal/mol
Thermodynamic ensemble
Free energy: -680.83 kcal/mol
Frequency: 0.0000
Diversity: 727.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((......))).(((((.((((((......))).)))...((((((.....))))))(((((.(((.(((((((.((((..((((((.((((.(.((((((((..(((((.(.((..((....(((((...)).)))(((((.((((...)))))).))).((((..(((......)))..))))(((((.(((.((....((((((((((((((..((...)).)).)))))....)).))))).....))..))).))))).))..))))))))..)))))).)).).)))).)))))))))).))))))).))).)))))..((((....))))..(((.(((...........))).)))((((((.(((((.....(((......(((((((((((.((.(((((.(((.(((((((..((((((((((((....)))))))...........)))))..)))))))............((((((((((((.(((((........(((.((...(((((.((.((((((((.....((((.....)))).....((...(((((..((.......))..)))))..)).(((.((((((....)))))).)))((((.........))))..)))))))).)).))).))...)).))).(((((..((((((((((..(((...((.((.....))))..))).)))).))).)))))))).......))))).)))))(((.((((..........)))).))).))))))).((((...............)))).....((((..(((((((((........((((.((((......)).)).))))......))))))).))...........)))).............((((((((.(((......)))(((...((((..((((((.((..((((((...))))))........(((((........)))))............((((((((..(((((.((.((((((.(((((..(((..(((((.(((((((((......))))..........(((((((((.....................)))))))))(((((((..((((((((..((((.........)))))))).......))))..)))))))...((((.(((.((((((....((((((((((.(((((........((((........))))))))))))))).....))))...)))))).))).)))).))))))))))..))))))).).))))))((((((.(((.........))).)))))))).))))).........)))))))))).))).)))..)))).))))))))))).((((....(((((((((..((((.....))))..))))).))))....)))))))))))).)).)))))))))))......)))..)))))))))))..))))).(((((....))))).........(((........)))....(((.(((((((.......))))))).))).....(((((((((((((((.(((((((...((((((.((((((((((..(((..((((((........))))))((((..((((..........(((((((.(((.(((((........))))).))))))))))(((((((......)))))))))))..)))).((((((.((((....))))...))))))...((((((.((........)).)))))).........(((((((((......((((....(((((((((..((((((((...((((((...((((((.(((...(((((..((((.((((((((........(((.....(((((.....(((((((((((..((((...((((......))))....))))..)))....))))).)))......)))))))).......))))).))).)))).))))).))).))))))........))))))(((((.....(((.((((((((((((...)))))))))))).)))..))))).........)))))))).....)))))))))..))))......))))))))))))..)))))))))).))))))...)))))))..))))...........)))))))))))...))
Thermodynamic Ensemble Prediction
((,(({..{,,,|||,((({{.((((((......))).)))...,,||||}....})}))}|(({{.(((.(((((((.((((..((((((.((((.,..((((,(({{((((,{(.(((.((....((({{...|,.,,|(((((.((((...)))))).))).((((..(((......)))..)))){||||.|||.((.,.,((((((((((,,,((.(({{,,,..}.)))},,,,,)}.,)))).}}},)),}))),))))).})..)))))),)}}}))))).)))).)))).)))))))))).))))))).))).))))|(((((.{{{{(((,{{,((((((((((........))))).((((({{(((((.....{,,......(((((((((((.((.(((((.{((.(((((((..((((((((((((....)))))))...........)))))..)))))))............((((((((((((.(((((.,....,,({({(,...|||,({(({({,,{{,(.....{{{{.....}))}...},}})).(((((..((.......))..))))),.{{{((({((((,{{{,.||||||{|||({{{.{{{,....)))}..)))))))),}},||||}|,,....|}}|{{{,|.|{{.{||||||..|{{.,,||,||}..,,}}}|||})),,}}}.))).}}}}})))}}}}.,,))))).)))))|{{.((((...,......)))}.})),})))))).{(((...,,.....,|,|.)))}....,{{{{,,{,,{{{{{({{....,,|((({({{{.{,,..,|||,.||||,......|{(({|..|,...,...,}.,}}}}},..........{(((((({,(((,,,...}}}{((...{(((..{{{||{,|{,,({(({,..,})))))........{(({{......,,)))))........,,..{((({(((.,{{{{{.{{,{{{{{{,{{{{{,,{((..((((,,((((({(((,,,,,,||||{{{..{{{{{(((((((((.....,.{{........}}.,)))))))),.,,,,{|}}|||,.||},,{|||}|,..,|||))}|||||,|||,..}}}}..}}},))),..{(((.(((.((((((....((((((((({{(((((.......,(({{........)}}}))))))))))).....))))...)))))).))).)))}.))))))))))..)))))))}),)))))){{((((.{((.........))}.))))}}}}.})}}).........)))))))))),)}},,}),,)))}.))}}}))))},.((((..,.(((((((((.,((((.....))))..))))).)))),...)))))))))))).)).)))))))))))......,}}..)))))))))))..))))).(((((....))))),,.......,||,,,,,,}}))}...,{({{((({((,...,,|,|||||{{{{{{{((({,,{,|{{||{(({{{.,{{||||,}}||,|||}||||||||||}}||,|||}}}}}|{{{{{{({{.{((((((({.{{,{{{..(({{(((,,,.,,{{{.(((((........))))).},||||||{{{.,.((({{{{..||,,,|{{{,,.{(({{,{{(,,{,.,,.{((((((({.({...{{{{{((((((((({{,,.{{{{{{{,,,,...........)))|}}},})}.})).}})))}||,|)}|...}}.}))))))}),,||,,,}}|,,,}}}}|...{((((({((((({(,,,(((....,,{{{((({...{((({,.},,,|{||||{((,,..,,,|,.,((((..{{{{||,,....}|||..,,|{.{{|||||.|||{...{{|||||{{|,.{{(((((((.{{{,......},))).))),})))))........,,.)))|||,|}...}))}}||||||{||{{{.}}},,,,,}}))))})))}}))}))}},}...},}....)))),,))))))))),,.,,,,)},,...,,},)))))))...))))))))},.))))))}..,))),}}.}))))}}}}.))}}}}})))}.)).)))))).

Transcripts

ID Sequence Length GC content
GCCCGCUCGCCCGCGCGCCCCAGGACCCAAAGCCGGGCUCCAAGUCGGC… 2201 nt 0.4330
CUGAAAGCAAAUGGUGUGGCCGAAGCUGCCUCUCUGGUGGCAUAGCUAA… 2359 nt 0.3938
Summary

This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Sprague-Dawley rats demonstrated that mechanical unloading following spinal cord injury stimulates the production of receptor activator of NF-κB ligand (RANKL), a protein that drives cortical and trabecular bone deterioration [Deng et al. DOI:10.1038/s41598-025-17561-6].