Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUCCCCGGCCCGAUCCGCCCGCCGGCUCCCCCUCCCCCGAUCCCUCG… | 1377 nt | 0.6275 |
Summary
The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
Forensic Context
A study in mice demonstrated that the TNFSF12 (TNFSF12), a cytokine involved in apoptosis regulation, exhibited a stable expression level at 2 days post-injury but was significantly upregulated at 14 and 60 days following controlled cortical impact, indicating its involvement in the chronic phase of the microglial inflammatory response [Izzy et al. DOI:10.3389/fncel.2019.00307]. A study in humans demonstrated that severe burn injury significantly upregulates gene expression of inflammation and proteolysis regulators in non-burned skeletal muscle, including the TNFSF12 which was 1.75-fold higher in burn patients compared to matched controls [Merritt et al. DOI:10.1097/BCR.0b013e31827a2a9c]. Its receptor, Fn14, was elevated 6-fold, and other key atrogenes and cytokines like atrogin-1, MuRF1, IL-6 receptor, and SOCS3 were also markedly increased, collectively indicating a profound systemic catabolic response.