Basic Information

Symbol
TNFSF12
RNA class
mRNA
Alias
TNF Superfamily Member 12 TWEAK DR3LG APO3L Tumor Necrosis Factor (Ligand) Superfamily, Member 12 Tumor Necrosis Factor Ligand Superfamily Member 12 APO3 Ligand TNF12 Tumor Necrosis Factor Superfamily Member 12 TNF-Related WEAK Inducer Of Apoptosis TNF-Related Weak Inducer Of Apoptosis Tumor Necrosis Factor Ligand 4A APO3/DR3 Ligand TNLG4A
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003809.3
Sequence length
1377.0 nt
GC content
0.6275

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-588.30 kcal/mol
Thermodynamic ensemble
Free energy: -611.17 kcal/mol
Frequency: 0.0000
Diversity: 347.21
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((..((((((.....(((.(((((.((((((((.......((((((.(((((((.(((((((((((.(.(((.......))).)))))))))....)))))))..))).)).)))).)))))))).))))).)))(((.((((...)))).)))(((((.((....)).)))))))))))((((.((((((((.((((((.((((((((.((((((((((...((((((.((((.(((((((...(((((((..(.......((.(((((((((((.((((((((.((.((((..(((((..(((......))).(((..(((((((((....))).).))))))))..)))))..))))))))))(((....))).......((..(((((((((((((((((.......))).)))))...((((...))))........((((((((.(((.(((..(((((((.((((...(.(((.(((((((((((.((..............(((.(((((((((((.((.......))))))..(((((.(....).)).)))))))))))))....((((((......))))))....(((.(((((((((.((((((((((...(((.......))))))))))))).)((((((((((((((((..((((((((((...(((.....))))))))))...(((((.(((((((((((.....)))))...))))))..)))))...(((((((((((....((((....))))(((......)))........((((......)))).((((...((((.(((....)))))))....))))))))))))))))))..)))).))...))))..)))))))))))))).)))......(((((...((...))..)))))..))))))))))))).)))))))).)))))))((((......)))).))))))..)))))))).)))))))))..))...........(((......)))...........................))))))))).....)))))))).......)..))..)).)))...))))))))))).)))))).))))))))...(((...)))((((.(((((((........)))))))..))))(((((((....((((.(((........))).))))))))))).)))))))))).)))...))).).))))).))))))(((((((.(((..(.(((((((..............)))))))).))).)))))))((((...........))))........(((((((.((((.......)))).))))))).)))............
Thermodynamic Ensemble Prediction
.,{{{(,.((((((.,,,,{{({((({({(((((((((,.({{((..,||}||,,|||}.||||||||||}(,(((,{{{.,,}||{|||||||||.,.,||||||,..}),,},.}.))))),))))),)}}))}))((({,(((.((({{...}},))))))))))|||||||||,.}})))||||,||||||||}|||(((.(((((((,{((((((((((...((((((.((((.(((((((...((({{(({(...,..,,((.(((((((((((.((((((((.((.((((..(((((..(((......))).(((..(((((((((....))).)},)))))))..)))))..))))))))))(((....))).......||,.(((((((((((((((((.......))).)))))....,,,.,.||,|,,......||||{{((,(((.((,{,(((((((.((((..,(.(({.(((((((((((.((..{,,,,.......(((.(((((((((((.((.......))))))..(((((.{....}.)).)))))))))))))....((((((......))))))....,||,,(((((((.(({((((({...{,{(({{{{{...|{((|(((.((((,(((((,,,,,.{,,(({{((,(((((((...(((.....)))))))))).))||||{}||||,,|||||}}}}}))},)}}.|||||,..))))).|,(((((((({{,.,,.{{{{....)))){{,...,..|||{{,.....,{||..,,,,}}}},((((...((((.(((....)))))))....))))))))))}))}}..{{.((((((......)))))),)),}},},,}}.)))}},.,|||||}.}},}}))))))})}....))))))))))))).)))))))).))))))){(((......)))),}))))).}))))))),.)))))))))...,...........,((......,,,......................,,,..))))))))).....)))))),}....,,,)..,))})}.)))...))))))))))).)))))).))))))))...(((...)))((((.(((((((........))))))}..)))|(((((((....((((.(((.,,...,,))).))))))))))).)))))))))).)))...},)..,))))).,))}}}(((((((.(((..(.(((((((..,........,..))))))),.))).))))))){{{{,,.........}}}|{((((...(((((((.((((.......)))).)))))))..))))},....,},.

Transcripts

ID Sequence Length GC content
CUCUCCCCGGCCCGAUCCGCCCGCCGGCUCCCCCUCCCCCGAUCCCUCG… 1377 nt 0.6275
Summary

The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]

Forensic Context

A study in mice demonstrated that the TNFSF12 (TNFSF12), a cytokine involved in apoptosis regulation, exhibited a stable expression level at 2 days post-injury but was significantly upregulated at 14 and 60 days following controlled cortical impact, indicating its involvement in the chronic phase of the microglial inflammatory response [Izzy et al. DOI:10.3389/fncel.2019.00307]. A study in humans demonstrated that severe burn injury significantly upregulates gene expression of inflammation and proteolysis regulators in non-burned skeletal muscle, including the TNFSF12 which was 1.75-fold higher in burn patients compared to matched controls [Merritt et al. DOI:10.1097/BCR.0b013e31827a2a9c]. Its receptor, Fn14, was elevated 6-fold, and other key atrogenes and cytokines like atrogin-1, MuRF1, IL-6 receptor, and SOCS3 were also markedly increased, collectively indicating a profound systemic catabolic response.