Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUCUCGUCAUGGAAUACGCCUCUGACGCUUCACUGGACCCCGAAGC… | 1634 nt | 0.5704 |
Summary
The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This transmembrane cytokine is a bidirectional signal transducer that acts as a ligand for TNFRSF9/4-1BB, which is a costimulatory receptor molecule in T lymphocytes. This cytokine and its receptor are involved in the antigen presentation process and in the generation of cytotoxic T cells. The receptor TNFRSF9/4-1BB is absent from resting T lymphocytes but rapidly expressed upon antigenic stimulation. The ligand encoded by this gene, TNFSF9/4-1BBL, has been shown to reactivate anergic T lymphocytes in addition to promoting T lymphocyte proliferation. This cytokine has also been shown to be required for the optimal CD8 responses in CD8 T cells. This cytokine is expressed in carcinoma cell lines, and is thought to be involved in T cell-tumor cell interaction.[provided by RefSeq, Oct 2008]
Forensic Context
A study in rats demonstrated that the TNFSF9 was significantly upregulated in microglia/macrophages from the striatum and prefrontal cortex at 2 hours after a binge methamphetamine regimen, showing a 19.5-fold increase in the striatum and an 11.5-fold increase in the prefrontal cortex, indicating its role as an M1-associated inflammatory marker [Kays et al. DOI:10.3390/brainsci9120340]. In a separate rat model of radiation-induced lung injury, single-cell transcriptomic analysis identified the TNFSF9 as a gene associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].