Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCGACUCACUUGCAACUCCACCUCAGCAGUGGUCUCUCAGUCCUCUC… | 1205 nt | 0.4232 |
Summary
This gene encodes a protein that is related to chondromodulin-I, which is a cartilage-specific glycoprotein that functions to stimulate chondrocyte growth and to inhibit tube formation of endothelial cells. This protein is also an angiogenesis inhibitor. Genetic variation in this gene is associated with a risk for type 2 diabetes, central obesity and serum levels of systemic immune mediators in a body size-dependent manner. This gene is also a candidate gene for age-related macular degeneration, though a direct link has yet to be demonstrated. [provided by RefSeq, Sep 2009]
Forensic Context
A study in humans demonstrated that the TNMD gene was upregulated in the subcutaneous adipose tissue of heavier co-twins within BMI-discordant monozygotic twin pairs, associating with unhealthy obesity characterized by hyperinsulinemia and large adipocyte size [Muniandy et al. DOI:10.1038/ijo.2017.95]. A subsequent human intervention study found that the TNMD was the most downregulated gene during short-term weight loss and was also downregulated during long-term weight loss, with its expression pattern in weight loss being the opposite of that observed in acquired obesity [Bollepalli et al. DOI:10.1038/ijo.2017.245]. A study in rats showed that the TNMD mRNA expression was significantly decreased in skin incision wounds at 1 and 3 days post-injury, identifying it as an anti-angiogenic factor [Kameyama et al. DOI:10.1016/J.Legalmed.2015.02.007].