| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGACGAGAACCAGGGACGACCAGCAAGUACCAAGGUCUGCGGCAGGAG… | 5042 nt | 0.5609 |
Predicted to enable integrin binding activity. Involved in positive regulation of sprouting angiogenesis; regulation of cell adhesion; and regulation of cell migration. Located in collagen-containing extracellular matrix. Part of tenascin complex. [provided by Alliance of Genome Resources, Apr 2025]
A study in mice demonstrated that following a moderate unilateral cervical contusion injury, the endogenous level of the TNN exhibited a significant 3.7-fold increase at the lesion site 30 minutes post-injury, which gradually decreased to 0.2-fold by 7 days, with minimal changes in rostral and caudal spinal cord segments and a delayed 2.62-fold increase in the ipsilateral prefrontal motor cortex at 7 days [Yu et al. DOI:10.3390/ijms25053058].