Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAAGCUGUCCUGUGAGCCGCCAGCAUGGAUGACAUCUACAAGGCUGC… | 687 nt | 0.5691 |
Summary
Troponin is a central regulatory protein of striated muscle contraction, and together with tropomyosin, is located on the actin filament. Troponin consists of 3 subunits: TnI, which is the inhibitor of actomyosin ATPase; TnT, which contains the binding site for tropomyosin; and TnC, the protein encoded by this gene. The binding of calcium to TnC abolishes the inhibitory action of TnI, thus allowing the interaction of actin with myosin, the hydrolysis of ATP, and the generation of tension. Mutations in this gene are associated with cardiomyopathy dilated type 1Z. [provided by RefSeq, Oct 2008]
Forensic Context
A study in pigs demonstrated that the TNNC1 expression in muscle tissue was significantly up-regulated in the first area of impact compared to others following experimental blunt trauma [Barington et al. DOI:10.007/s12024-017-9869-2]. A study in rats demonstrated that cardiac troponin C (cTnC) is a marker of myocardial ischemia, as noted in the literature [Sabatasso et al. DOI:10.1007/S00414-016-1401-9]. In forensic pathology for post-mortem interval (PMI) estimation, the TNNC1 degrades as PMI advances, showing minimal levels at 50 hours post-mortem, and its expression pattern differs based on the cause of death, such as stab wounds versus firearm injuries [Lopez & Navadijo DOI:10.1016/J.Forsciint.2025.112412].