Basic Information

Symbol
TNNC2
RNA class
mRNA
Alias
Troponin C2, Fast Skeletal Type CFAP85 FAP85 Troponin C, Skeletal Muscle Troponin C Type 2 (Fast) CMYO15 CMYP15 MYONRI
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_003279.3
Sequence length
681.0 nt
GC content
0.5830

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-268.40 kcal/mol
Thermodynamic ensemble
Free energy: -280.13 kcal/mol
Frequency: 0.0000
Diversity: 93.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((...((((((.((((...((.(((..((((...))).)..)))))(((..((((((.((.....(((((....(((....))).)))))...((((((((........)))))))).(((..(((((((..(((.(.(((((((((((((..........))))))))))))).))))))))..)))..))))).))))))))).).)))))))))..)))))((((..((((.(((((.(.....).))))))).)).)))).(((((((((...(((((.....)))))...))))))))).((((((....((((((.((.(((((...(((........)))(((((..(((((((............)))).)))..)))))....(..((((((((..((((.........))))..))))))))..)..(((.....))).((((((...))))))..((..(((.((((((..(..((...(((.((.((((..(((((.........)))))..))))..)).)))...........))..).)))))))))..))...((((((.(((((...(.(((((.(((((.((...)).)))))))))))))))).)))))).))))).)).))))))))))))..((((((........))))))....
Thermodynamic Ensemble Prediction
.(((((...((((((.(((,...((.(((..((({...}}},),.)))))(({,.((((((.((.....(((((....(((....))).)))))...((((((((........)))))))).(((..(((((((..(((.(.(((((((((((((..........))))))))))))).))))))))}.,))..))})).))))))))).,.)))))))))..))))}((((..((((.(((((.(.....).))))))).)).)))).(((((((((...(((((,...,)))))...})))))))).((((((....((((((.((.(((((...(((........)))(((((..(((((((............)))).)))..))))).,.,(..((((((((..((({.........))))..))))))))..}..(((.....))).((((((...))))))..||..(((.((((((.....,..,.,({,((,((((,.(((({......,..,}}}).,}})),,)).))),|,,}.....,))..,.)))))))))..,....((((((.(((((.,{{.{((((.(((((,((...}}.)))))))))))))))).)))))).))))).)).))))))))))))..((((((........))))))....

Transcripts

ID Sequence Length GC content
AUCUUUGGGUGGUGGAGUGCAAAGGAGGCGACCUGCAACAGAGGAGUCC… 681 nt 0.5830
Summary

Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit. [provided by RefSeq, Jul 2008]

Forensic Context

A study in pigs demonstrated that the TNNC2 exhibited highly variable, non-linear regulation in muscle tissue following high-force blunt trauma, but its expression in muscle did not reliably reflect bruise age or impact force [Barington et al. DOI:10.007/s12024-017-9869-2]. In a separate investigation of cold exposure in Tibetan and Bama pigs, the TNNC2 was measured as a fast skeletal muscle fiber type marker, though no significant expression change was reported in the main findings under the experimental conditions [Yang et al. DOI:10.3390/ijms24087431].