Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUUUGGGUGGUGGAGUGCAAAGGAGGCGACCUGCAACAGAGGAGUCC… | 681 nt | 0.5830 |
Summary
Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit. [provided by RefSeq, Jul 2008]
Forensic Context
A study in pigs demonstrated that the TNNC2 exhibited highly variable, non-linear regulation in muscle tissue following high-force blunt trauma, but its expression in muscle did not reliably reflect bruise age or impact force [Barington et al. DOI:10.007/s12024-017-9869-2]. In a separate investigation of cold exposure in Tibetan and Bama pigs, the TNNC2 was measured as a fast skeletal muscle fiber type marker, though no significant expression change was reported in the main findings under the experimental conditions [Yang et al. DOI:10.3390/ijms24087431].