Basic Information

Symbol
TNNI1
RNA class
mRNA
Alias
Troponin I1, Slow Skeletal Type SsTnI Troponin I Type 1 (Skeletal, Slow) Troponin I, Slow Skeletal Muscle Troponin I, Slow-Twitch Isoform TNN1
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_003281.4
Sequence length
6110.0 nt
GC content
0.5447

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2357.40 kcal/mol
Thermodynamic ensemble
Free energy: -2466.54 kcal/mol
Frequency: 0.0000
Diversity: 1595.09
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((..(((((.((((..((((((((((..(((((((((..(((((.(((....(((..(.(((((((.((........)).))).)))).)..))).....))).).))))..(((...((..(((....)))..)))))((((....)))).)))..)))))).(((((.((((((((((((.(.((.......((((((((.(......)))))))))))).))))((((.((...)).)))).)))).))))))))).)).))))))))....))))....((..((((...((((.((((..((..((((.....))))...))..)).)).))))..))))..)))))))..))))(((((((((((((((..((....))(((((...(((.((.((.(((((.(((.((.((((..((((((((..((((((.((((..((((((....))))))..))))...))))))...((((((((((((((.(((.((((.(((...(((((((((..((((((.((((((((((((((((((((((((((((.((((((((((((((((((....)))).((..(((.((((.((....((........))....)))))).)))..)).(((((..((((.......))))..)))))........))))))).))))))).....)))).))))))))))))...((.......))(((((((..((((.((((((((((.(((((((((((((((((.((((.((((((((((..(((........)))....)).))))).)))..........(((...((((.((.((((((...))))))))))))....))).))))))))((((((((...........))))).)))........)))))).))))))))))).)))).((((.(((((..((((((((((.((((.........)))))))).(((((....)))))....(((((............((((....))))....(((((.((((((((((((((((((((((.............))))))))))....(((.((((.((.(((((...))))))))))).)))))))).))))))))))))...))))).)))))).)))))..))))(((.((((((((((((((.(((((((((((..(((((....(((((..(((((.(((((....(((.(..((((((.(((.........(((.((((((((((((.......(((((..((((((((((((....((((..(((.((((((..(((......)))..)))))).)))..))))......(((((((((((((....((((...(((((((..((......).)..))))))).))))((((((.((((((((((((..(((.((((((.....)))))))))))).(((......)))...(((((.(((((((((((((...))))))..((((((..((((.((((.((((((.((((((((((((((.(((((..((((((.(........(((((((((........(((((((.((((((......((((((((((((((((.((........(((((((.((((((((......((((((((...))).))))).......))))))))....)))).))).....))))))).).).).))))))))....)))))))))))))(.((((((((((((.((((..................)))).))))...((((((((((((.(........((((((((((.....................)))).))))))(((((.((..(((.((((.((((((((((((..((....))..))))))))..))))))))....))).)))))))((((((.(((((.......((((..((((((.......((.((((((((........(((((...........))))).......(((((((...(((..(((((((..(((.....)))))))))).))).((((((((((((.(...(((((......)))))...)))))).....((((......))))..(((((((....))))))).(((((((((.(((((...((........(.(((((.....(((((((.(((..(((((((...(((......)))..)))))))..)))(((((....)))))(((....))))))))))..))))))........))...))))).))))))))).............(((((..........))))).......((((((........))))))((((((((((((((..(((((((((((...)))))((((((((((((((............)).))))))).....))))).....)))))))))).)))).)))))).(((((((((..(.(((..........))).)..))))))))).))))))).(((((.....)))))................))))))))).)))))).))...))))))))))......))))).))))))(((...)))(((((((((((((((.(((((.((((...((((....((((........))))))))..(((.......))).))))((((....)))))))))..).)))))))))))...)))).))))..))))))))......((((((((.....)))).))))......)))))))).).........((((((.(((((.(((......)))(((((..((((((((((.......))))))).)))...((((((...))))))..))))))))))))))))......((((((.......)))))))))))))))).)))))).................)).))).)))).....)))))))))).))))))...((.((((((((((((((.((..(((.....)))..)))))))))).)))....((......))....))).)))))).))))..))))))...................)))))))))))))))))))))))))))......))))))))))))).))))))))))))..))).)).........((((((.((..(((((((..(((((((((((((((((..((((((.((((((.(((((.((((((((((((((((((......))))).....(((((...)))))...((((((((.((((((((((....)))).......((((.......(((.((((...((.((.(((((...((((.....))))..................(((((.((((....)))).)))))...))))))).)).....)))).)))..((((((((...))))))))...........))))...)))))))))))))).....(((((..(((.(((.(..(..(((((..(((((((..........((((.(((((((.((((.((........)).))))))))))))))).((((((((((((((.............))))))).......)))))))........)))))))..)))))..)..).))).)))..((((((.......)))))).))))).((.....)))))))))))..))))..)))))...)))).))..))))))))))...((((....))))))))))....))).))))....)))))))....))))))))))))))).))))).))).....)))))))))..)(((((................)))))...........))).)))))))))).))))).)))))..))).).)))))........)).))))))))))).)))))))).))))..)))))))....(((((...(((((......(((((........))))))))))..)))))...((((((.....)))))))))))))....)))))))))))((((((.......))))))(((((......)))))...(((((((((((((((........((((((.(........)))))))......(((((((((((((.((...))..)))))(((((((((..(((((((.....).))))))((..((((((..((((((..........((.(((((((((...))).)))))).))...)))))))))))).))((((((((((((...(((((((.((..((((((...(((((.(((((...)))).......(((.(((((((..(((((..(((((((((.......))))))))).(((.....)))..)))))...))))))))))).))))).))).))))))))))))..))).)))))))))...........)))))))))...((((((...........))))))))))))))............)).)))))))))))))....)))))))))....))).))))..))).)))))))))))))).))))))))..)))))))))))))).)))).)))...))))).(((.((((((((....))).))))).)))....((((((((((((((((((.(((((((((..(((..((........))..)))..).))))))))((((((((...)))))).))..(((((....((((((((((((..((((((((((((.((((((.(.(((((...((((..((((((........))))))....))))(((((.....((((...((((((((((.(((......))).)))))))))).)))))))))..))))).).))))))))))..))))))))(((((((((((.((((((((((((((((((((.((......(((((((.(.((((((((.(.((((((.(((((.(((((..((((.(((....))).))))..(((((.....)))))..((((..((((...(((((.......)))))))))..)))).)))))))))).))))..)).).)))))).....)).).)))))))..)).))))))))))))).(((((((((........................)))))))))(((((.(((((.....(((((((((.....))))...(((........((((.((((......)))).))))......))).)))))))))).)))))......(((((((((((((.(((((((((................)))))).)))))))......)))))))))...(((..(((((....(((((((((....(((...((.(((((.((((............((((....))))......((((((((....)).))))))((((((.((((...(((.......................)))...)))))))))).((((..(((.(((....((.((((((............((..(((...((((....))))..)))..))((.((((((.((((((((..(((((((((....)))))))))(((((...(.(((.((((((((((..(........)..)))))))))).))).)...)))))......(.((.((((((((....))))))))...)).)((((((.((.......)).)))))).))))))))))))))))..........(((((((((........)))))))))..)))))).))...))).)))...))))..(((((.(((.........))))))))...((((((.........))))))........)))).))))).)).)))))))).))))...)))))..)))))))).)).))).)))))))).)))))))).....))))....)))))......)))))))))))........(((((((((.........))))))))).........))))))).((((((((((....))))...)))))).........)))).))))))))))).
Thermodynamic Ensemble Prediction
.{{((((..,((((.{((,{{,,(((((((((((((((,(((....))}}}}..,..((((.{{({{,||.|{|,,,..}..{({{{..|{(((({{{(({...,|||..{||||,.(((..,{{||||.,,})})}.}}})||((((....))}|,|||..||||||{((((({(({.(((((((((.(((((.{...((((((((.,......}))))))))|((({((((((({...{{{,({{{{{{{|{.,,||||,,|{||.|||,||||{{{.||||{{.{(..,((,((((((((.(((.({((.,,,..........{{((|,....}))}),,,..|,||{,{|||,||..,,||((|,,{{{{,||||,,{{||.}}}|{((((..{{,{.{{,(({((|,,,{(({((,((,(,,,,,|||||},|||||{.{(({..((((((....))))|},.}|||,..|)})}}...{{{{,{(((((((..{(({,,,({((({..,,,,,,,{,}}||||,..{|||,||||}||((((((((((((((((.((((((((((((((((({.,..}})),({,.(((.(((,.{{.,..,{,,.....,},,..,)))))).)))..},.,((((,.((((.......)))).,))))},{{....}))))))).)))))))},...)))).)))))))))))),,,})}))}}.}))|||||||}}||||.}||||||,||}|||||,||||,,.}}.}}}}.)}((((((((((..(((........))).,.,))}))))).)))......{.(((.(((....)))))).}}}})))}(((((({......}))))))...))),.}|}}}))}{{{{{{{{{{{{{{{{|||,.......||||||{|||||||||||{|,,.,||||}||||}}}.((,((((({{((((.........)))))))))},||,..{{||||.,.({((,{{{{,..,.....{((,,..{{||,,{{{.(((((.((((((((((((((((((((((.............))))))))))....(((.((((.((.(((((...))))))))))).))))))))}})))))))))))..}))}))))))),),))))}..))))|,|}|}}|(((((,,,,|}|||((((((((..(((((....(((((..(((((.(((((....{((.{..((((((.(((...,.....(((.((((((((((((.......{{(((..((((((((((({..,{((({..,((,((,((({(((......})))}},))))).,})}}))},......(((((((((((((....((((,,.,,,((((..,{.},.,,...,}))))))}.}}}}((((((.((((((((((((,.{((.((((((.....)))))))))))).(((......)))...(((((.(((((((((((((...))))))..,((((,..{((({({{{.((((((.((((((((((((((.(((((..(((({{.{........((((((((({...,,,,(((((((.((((((.,....((((((((((((((((.((........(((((((.((((((((......((((((((...))).))))).......))))))))....)))).))).....))))))).).).}.))))))))..,.)))))))))))))((((((((((((((.,,((({{{......{{(((....)))}}||,,,,((((((((((((..,{{{{...,|))}}||||.....................)))}.||||,,(((((.{(..(((.((((.((((((((((((..((....))..))))))))..))))))))....))).}}))))).,||||,|||||,...,,.||||,,{{||||....|,|((||{,{,({{{,...{{{(((,,...,,,,,...|}}}},}||{{,(({{,{{.}},||,.(((((((..({,.....}),))))))).,,,..,,,((((((((.(...(((((......)))))...)))))).}.}}((((......))))..(((((((....))))))),|||||{|||}|||{|,...||...,,,,},,,}))))).)))))}})))}}}}|((((({...,{((,....,},,,}}}}})}..,|||,,,((((((((((((..,.....},.))))..)))))))}.,,,......,||||}.}}}|}},,,,,,,,...,,{,{{{.,,...........((((((,...,))))))...,.{{{{{.,,.||}|},|((((((({{.((((({(({({{{((|.{((((((((((((((..,,........)).))))))).....)))))}{(((((((({.{({.{(((({{,,{{.(((((((((..{.,((,,........))).}..))))))))).,)).|,|,(((((.....)))))................,,..,,|||.,|{|,|{{|....,..)))),..})},}).{({((((({...,{{((((({(((((((((((((.(((((.((((,,.(((,...,((((........))))))))...,,,,}}}......,}}}((((....)))))))))..),})))))))),)},.,},.....))))))),,,....}})))))))))))))}.)))..))))))))))}})))))}||,...(((((.{{.,.{{....}}...}}.)))))(((,..((((((((((.......))))))).)))...)))||,}))))))))))))),,,}}}}}..,},....,,|||||{...,,,}))}}}))))))))))},)))))).................)),})).)))).....)))))))))).))))))...|}}}}}(((((((((((,{{..(((.....)))..}))))))))).)))....,.{{,..{{{{{{{,,,.,}})))}))),..)))}}).....,}}}..........)))))))))))))))))))))))))))....,.))))))))))))).,)))))))))))..))).}}.........((((({{((..(((((((..(((((((((((((((((..{(((((.((((((.(((((.((((((((((((({((((,.....))))).....(((((...)))))..(((((,((({(((({(((((....{{||{,....}|}}}..}}}}}||,},|||}}.}}})).{{{,....{(({.....}}},.....,,....,{{....(((((.((((....)))).)))))..})},,,}|||||{{..|||,{||,,,((((((((...)))))))).,|.,,,{.{.|||....))))))))))})))..}}}.,|||..(((.(((.(.,(..(((((..(((((((...,,,,...,{{{.{(((({{.{{{||{{......||||,||}}})))))}|,,,.{{{||{{{{{||||,,,,.........}}))|||.,,,,,.}}}}}))}},.,,,.)))))))..)))))..},,),))).)))..((((({.,,,,,.,}}},}})))),,||...,,)))))))))))..))))..)))))...)))).))..)))))}))))...((((....))))))))))....))).))))....)))))))....))))))))))))))).))))).))),....))))))))),.}|((((................))))}......,....)}).)))))))))).))))).))))).,))).}.)))).}}}}))}.))})))),,,))))}))))}.,)}))))}))),))),....(((((...{(({(......{((((........)))))))))).,)))))...,}))))))).,)))).,.}.))))).))))))))),,}}{{{(((,,...,.}))}}|(((((......))))),..|||||||||{{||||||,..,,}|||||,.},}}}..||||||}||,|{||,(((((((((((((,(,....,.}))))){((((((((..(((((((.....}.)))))),{..((((((..{(((((......{{{.{(.(((((((((...))).)))))).))...)))))))))))).||((((((((((((...(((((({,((..(((,{({,.(((((,{((((...)))).......(((.(((((((..(((((..(((((((((.......))))))))).|,({{...,)),.)))))...)))))))))),.))))).))).))))))))))))..)))}})))))))),.......,,.))))))))}...((((((..,.....}..)))))))))))))).........,}}))))},)))))})))))))))))),))))).||}}}.}}})...)))))))))))),,))}})}})))),.}))))).,,,||||,.,,,,.,,,.}})),...(((.((((((((....))).))))).)))..{,(((((((((((({{,,,(((((((.....)))))))..,{{{...(((((..((((((..((({(,((((((...)))))).)),.,{{((,,(,({({((((((((,.{(((((((((((.((((((.(,(((((,..((((..((((((........})))))....)))){{{{{.....|||{...((((((((((.(({......})).)))))))))).))))))))}..))))),).))))))))))..}))))))}(((((((((((.{{((((((((((((((((((.((......(((((((.{.((((((((.,,({((((.(((({{(((((,.((((,(((,,,.}}}.})))},|||{|,,...}}}}}..((((..((((,..,((((.......)))))))))..)))),)))))))))).)))),,,}.,.)))))).....)).).)))))))..)).))))))))))))).{,{(((((({...,{{{(({..{{{(,,,..,.|....)),)||,.,.,|||...,....||||||||}}}}))))}}}|{....,{,,.((((.((((......)))).))))......,||||||,||||||{|||||{{,...(((((({{,,,,{,,,((,,,,,...}}..,.{{{{{{{|||}|}.,}).)))}}}}}}))))))))},,,}||..,,|||||||{({((({{|,...,|||,,{{,|{{{{.{{{{,.,,........{{||},..},}}......((((((((....)).))))))(((({{{((((,{.(((.......................}}}...}}}})))}}|,((({..{{{.|||,...((.({((({.|......,,..((..(((...((({....})))..)))..)){{.((((((.((((((((,{{((((((((....))))))))}(((((((((.(((,((,,(((({{..,..}}}}..{{{||||||}}}}}))),)}}}||||,{{...}).))}|(((((((....))))))))}}}...))),))))),})}),,..,.,}}}..}))))))))))))))}}.....,..,.{((((((((........))))))))),.)))))).))...))).))),},})))..{(({{{(((.........)))))))}...{(((((.......,.))))))......,{,|||{||||,.,..,,,,}}},..,},.}}))))),.}}.))))).}}.))).))))))))}))))))))...,,))))....}}}},....,}),)))))))))))...}}}|((((((((.........)))))))),...,))))})))))))}((((((({((....}})}..,))))))..,{.,,.,|.,,.,,,,)),)))).

Transcripts

ID Sequence Length GC content
ACAGUCUGCAGUCUACGGCGAGGCACAGGCCAGCCCAGCUCCACGAGGA… 6110 nt 0.5447
Summary

Troponin proteins associate with tropomyosin and regulate the calcium sensitivity of the myofibril contractile apparatus of striated muscles. Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. The TnI-fast and TnI-slow genes are expressed in fast-twitch and slow-twitch skeletal muscle fibers, respectively, while the TnI-cardiac gene is expressed exclusively in cardiac muscle tissue. This gene encodes the Troponin-I-skeletal-slow-twitch protein. This gene is expressed in cardiac and skeletal muscle during early development but is restricted to slow-twitch skeletal muscle fibers in adults. The encoded protein prevents muscle contraction by inhibiting calcium-mediated conformational changes in actin-myosin complexes. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.