| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGUCUGCAGUCUACGGCGAGGCACAGGCCAGCCCAGCUCCACGAGGA… | 6110 nt | 0.5447 |
Troponin proteins associate with tropomyosin and regulate the calcium sensitivity of the myofibril contractile apparatus of striated muscles. Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. The TnI-fast and TnI-slow genes are expressed in fast-twitch and slow-twitch skeletal muscle fibers, respectively, while the TnI-cardiac gene is expressed exclusively in cardiac muscle tissue. This gene encodes the Troponin-I-skeletal-slow-twitch protein. This gene is expressed in cardiac and skeletal muscle during early development but is restricted to slow-twitch skeletal muscle fibers in adults. The encoded protein prevents muscle contraction by inhibiting calcium-mediated conformational changes in actin-myosin complexes. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.