| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACACUUUCUCCUCUUACUUCUCACCCUGGGGAAUUCCAAGACAUUGUC… | 757 nt | 0.5971 | |
| ACACACCACACAGCACCAUGUCCCAGUGCAAGAAGCGGAACAGGGCCAU… | 693 nt | 0.6075 | |
| AACUCGCCGCUGCCGGCCUGACCUCGCUCCCAGCCCUGCUGCCCAGAUU… | 751 nt | 0.6138 |
This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
A study in pigs demonstrated that the TNNI2 was expressed in skeletal muscle tissue and showed highly variable, non-linear regulation after high-force impact in bruises [Barington et al. DOI:10.007/s12024-017-9869-2]. In human forensic science, a separate study developed a multiplex assay where the TNNI2 was validated as a specific mRNA marker for the identification of skeletal muscle tissue, though it showed cross-reactivity with thyroid tissue, and was successfully applied to analyze samples from violent crimes including a blind test set [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7].