Basic Information

Symbol
TNNI3
RNA class
mRNA
Alias
Troponin I3, Cardiac Type TNNC1 CMH7 CTNI Cardiomyopathy, Dilated 2A (Autosomal Recessive) Troponin I Type 3 (Cardiac) Troponin I, Cardiac Muscle CMD2A Cardiac Troponin I Troponin I Type 3 CMD1FF RCM1
Location (GRCh38)
19:55151767-55157773
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000363.5
Sequence length
843.0 nt
GC content
0.6109

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-338.1 kcal/mol
Thermodynamic ensemble
Free energy: -353.93 kcal/mol
Frequency: 0.0000
Diversity: 233.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((.((((((((((.((((((.(..((((...(((((...))))).....)))).)))))))((((((((((((....((((...(((((((((((((.(..(((((((((((...(((((((.((.((.((((.((((((.((((.((((((.((..((.((((.......))))))..))(((((..((.(.((((((((((((.....(((.((....))..))).(((.(.(((..(((.....)))....((((......)))).....(((((.((....)).)))))((((...)))).(((....)))...))).).)))))))))))))))).)).....))))).))))....)).))))))))))...)))))).)))))))))...)))...(.(((((((..((.(....)))..))))))).)(((..((((......(((..(......)..)))..))))..))).....(((((..........(((((.(((.((((((........)))))).))).))))).(((..((....)).)))....(((((((((.......)))))))))..(((........)))(((...((((((((((((((.((....))))).))..))))))).))...))).)))))...)))))).))..).).))))....)))).))))))))...((.(((.((...))..))).)).)))))...)).)))))..........)))))))).))..((((((((.......((....))....))))))))))))))))....(((((......)))))....
Thermodynamic Ensemble Prediction
....(((((((({(((((({{((.{(((((.(,.({((...(((((...}))}}.....)))).))))))}{||(((({({{{....((((...{((((((((((((,,..(((((((({((...(((((((.((.((.((((.((((((.((((.(({(({.{({{((.((({..,,,.,))}}))..,.||{{{..((,(,((((((((((({..{{.((((((,...||..,|}.|{,,,.,,,..(({.....}))....,((({({(((.,,......,{{(({..,,.,{{{{{|,,{((|...}))}.}))},}})))..})),.))))))))))}))))))),))}....))))),))))},,,)).))))))))))...)))))).)))))))))..,)}|,,(({(((((((..((.(....)))..))))))).||{({(((((,.{..(((({,{...........,..,.,...,,,....,))}}}..}..}}.}}|||{{.{{,.((((((........)))))).|}}.}}}}},||{..{{....}},}})},,,(((((((((.......))))))))).,(({.,...,,.)))}(((({(((((((((((((,{((....))))).))..))))))).))...))))))))},,.)))))).)).,}.).,))}....)))).)))})))),,|((.(((.({...})..))).)).|||||...||,||||},,........})))}}},,)}..|||||||{..,,,,,,,,...,|....})))))))))))))))....(((((......)))))....

Transcripts

ID Sequence Length GC content
NM_000363.5 NCBI
AGUGUCCUCGGGGAGUCUCAAGCAGCCCGGAGGAGACUGACGGUCCCUG… 843 nt 0.6109
Summary

Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). Troponin I is useful in making a diagnosis of heart failure, and of ischemic heart disease. An elevated level of troponin is also now used as indicator of acute myocardial injury in patients hospitalized with moderate/severe Coronavirus Disease 2019 (COVID-19). Such elevation has also been associated with higher risk of mortality in cardiovascular disease patients hospitalized due to COVID-19. [provided by RefSeq, Aug 2020]

Forensic Context

A study in human cadavers demonstrated that the TNNI3 mRNA expression in blood was significantly higher when the cause of death was mechanical asphyxia compared to other causes like sudden cardiac death (SCD), multiple trauma, or other natural deaths, likely due to a sensitive response to acute systemic hypoxia/ischemia [González-Herrera et al. DOI:10.1016/j.forsciint.2019.109876]. An earlier methodological study confirmed that the TNNI3 mRNA remained stable postmortem, with no significant differences in its gene expression between samples collected at postmortem intervals (PMI) of ≤12 hours and >12 hours, supporting its reliability for forensic analysis [Gonzalez-Herrera et al. DOI:10.1016/J.Forsciint.2013.08.001]. A study in rats and H9c2 cells demonstrated that the TNNI3 was upregulated in ischemic models [Tian et al. DOI:10.1038/s41598-021-84056-5].