| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCCCGCUGAGACUGAGCAGACGCCUCCAGGAUCUGUCGGCAGCUGC… | 1259 nt | 0.5616 | |
| AGUCCCCGCUGAGACUGAGCAGACGCCUCCAGGAUCUGUCGGCAGCUGC… | 1117 nt | 0.5640 | |
| AGUCCCCGCUGAGACUGAGCAGACGCCUCCAGGAUCUGUCGGCAGCUGC… | 1120 nt | 0.5679 |
T his gene encodes t he cardiac isoform of t roponin T . T he encoded pro t ein is t he t ropomyosin-binding subuni t of t he t roponin complex, which is loca t ed on t he t hin filamen t of s t ria t ed muscles and regula t es muscle con t rac t ion in response t o al t era t ions in in t racellular calcium ion concen t ra t ion. Mu t a t ions in t his gene have been associa t ed wi t h familial hyper t rophic cardiomyopa t hy as well as wi t h dila t ed cardiomyopa t hy. [provided by RefSeq, May 2022]
A study in humans and mice demonstrated that the TNNT2 was used as a reference gene for single-molecule fluorescence in situ hybridization (smFISH) quantification to normalize signals from other cardiac stress markers, such as NPPB and ANKRD1, in myocardial tissue [Kuppe et al. DOI:10.1038/s41586-022-05060-x]. A study in rats demonstrated that the TNNT2 shows depletion from groups of cardiomyocytes as early as 1 hour after left anterior descending coronary artery ligation, serving as an early marker of myocardial ischemia [Sabatasso et al. DOI:10.1007/S00414-016-1401-9]. A review of post-mortem interval estimation techniques further indicates that the TNNT2 degrades into fragments as the post-mortem interval advances, with the most degradation occurring in the first 50 hours and remaining detectable up to 230 hours post-mortem in human and other species' tissues [Lopez et al. DOI:10.1016/J.Forsciint.2025.112412].