| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAAAGCCCCUCAUUUUGGCAGAACUUACCAUGUCGACCAGCCGCAAAU… | 407 nt | 0.4988 |
Transition protein-1 is a spermatid-specific product of the haploid genome which replaces histone and is itself replaced in the mature sperm by the protamines (see PRM1, MIM 182880; PRM2, MIM 182890) (Luerssen et al., 1990 [PubMed 2249851]).[supplied by OMIM, Mar 2008]
A study in humans characterized the TNP1 as a novel mRNA marker for the detection of semen containing spermatozoa, demonstrating strong and specific expression in semen samples with spermatozoa and showing higher sensitivity than a well-known marker with a statistically significant increase [Albani & Fleming DOI:10.1016/j.scijus.2017.09.002]. Subsequent research in humans developed an RT-LAMP-CRISPR assay for the TNP1, confirming its specific detection in semen samples and demonstrating its utility in a rapid, isothermal amplification method suitable for forensic screening laboratories [Lynch et al. DOI:10.1016/j.fsigen.2024.103167].