| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCUGUGUUCCUGGCCCGCGGCCGUCGGGUGUGAGCUGCGCCGACCG… | 3283 nt | 0.4054 |
Enables mitochondrion targeting sequence binding activity; protein-transporting ATPase activity; and unfolded protein binding activity. Involved in protein targeting to mitochondrion. Located in mitochondria-associated endoplasmic reticulum membrane contact site and mitochondrial outer membrane. Is active in mitochondrion. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans analyzing blood samples from burn patients identified the TOMM20 as a temporal expression profile gene exhibiting a significantly decreasing expression trend from 0 to 7 days after injury [Wu et al. DOI:10.1016/j.burns.2018.08.022].