| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGGUGUGCCGCACCACACGGGGGAGGAAGGAAGGAGCUCCCAACUCGC… | 1973 nt | 0.5236 |
The protein encoded by this gene is involved in the import of precursor proteins into mitochondria. The encoded protein has a chaperone-like activity, binding the mature portion of unfolded proteins and aiding their import into mitochondria. This protein, which is found in the cytoplasm and sometimes associated with the outer mitochondrial membrane, has a weak ATPase activity and contains 6 TPR repeats. [provided by RefSeq, Jul 2008]
A study in humans identified the TOMM34 as a single-gene blood biomarker, where machine-learning classifiers using differentially expressed genes could differentiate healthy controls from methamphetamine-dependent subjects with 87% accuracy [Breen et al. DOI:10.1038/tp.2016.67].