Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACCGACGCGCGUCUGUGGAGAAGCGGCUUGGUCGGGGGUGGUCUCGUG… | 5695 nt | 0.3893 |
Summary
This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010] CIViC Summary for TOP2A Gene
Forensic Context
A study in humans identified the TOP2A as a key dysfunctional gene whose expression was significantly correlated with survival in severe burn patients and was a risk factor for death in single-factor Cox regression analysis [Liang et al. DOI:10.21037/atm-22-3918]. In human epidermal keratinocytes, the TOP2A was downregulated (0.62-fold) 3 hours after exposure to 5 Gy of X-ray irradiation [Koike et al. DOI:10.1269/jrr.46.173].