Basic Information

Symbol
TOP2A
RNA class
mRNA
Alias
DNA Topoisomerase II Alpha TOP2alpha TOPIIA TOP2 Topoisomerase (DNA) II Alpha 170kDa DNA Topoisomerase II, Alpha Isozyme DNA Topoisomerase 2-Alpha DNA Topoisomerase (ATP-Hydrolyzing) DNA Topoisomerase II, 170 KD EC 5.99.1.3 DNA Gyrase EC 5.6.2.2 TP2A
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_001067.4
Sequence length
5695.0 nt
GC content
0.3893

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1444.80 kcal/mol
Thermodynamic ensemble
Free energy: -1560.78 kcal/mol
Frequency: 0.0000
Diversity: 1336.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((((((((((((((((((((....((((.(.((.(((...))).))).))))...))))))))...(((((....))))))))))))..((.((((((((.(((((.((((((.((((.((((.((....)).)))).))...........((((((.(((.(.(((..((((.(((..(((.((((......(((......))).........((((.((.....)).))))((((((.(((......))))))).)).....((((((((.......)))).))))(((((((..(((((((.........(((((.(((.(((((.(((((((((((.((.((((((....))))))....(((((((...(((((.....................))))).)))))))((((((((((((((.((((.((..(((.((((..........))))..)))..)).))))(((((((((...(((((((((.....((...(((....(.((((((.(((((((((((((...(((..((((((((((.................((((.....))))...(((((....)))))....((((((((...((.(((.....(((((((((....))..)))))))...))).......((((((..((....))..))))))....(((..(((..(((((.(((.........(((......)).).........)))...))))).)))..)))..((((((((.((((........)))).))))))))))...))))))))..(((.((....)).))).(((((((..(((.....)))..))))))).(((((((.(((.(((..........))).))))))))))))))))))))..)))(((((((((.(((((..((((......))))......))))).)....)))))))).........(((...)))))).))).))))))).)))))).).....)))...)).....))))))))))))))))))..(((((((...((.(((.....))).))....))))))).))))).)))))))))...((((.(((((((((.........(((((.((((((((((((((.(((..(((((...((((....)))))))))..))))))).))))))......((((((((....((((.(((((...................(((((((.((((.....))))((((.((.((((((.((((...............))).).)))))))))))).)))))))((((.(((...(((.((((.(((((..(((((.....(((((.((((.....)))).)))))...................(((....)))...((..((.((....)).))..)).))))).))))).)))).)))))).))))..((..(((((((..((..(((((((....)))))))..))...)))))))..))....))))).))))....))))))))((((...))))......))))..)))))((((....))))...((((............)))).......))))))))).)))).....(.(((((((..............(((((........)))))))))))).).(((((((......)))))))...))))))))))))).)))))))))))))............)))))))...))))))).....)))).)))..))).))))))).).)))))))))((((((.....)).))))(((((((((((((((.....((.((((.(((..(((........))).((((..(((((..((((((((...))))))))))))).........(((....((((((.........))))))...)))(((((((..((((......((((((.((((..(((((((.......))))))).....))))))))))..))))...)))).)))((((((((((((((((((((............(((.((((((.......)))))).)))......))))))..((((((((.....(((((.((((((..(((.....((((((...((((((((..(((.....((((((..........(((((((..((((......(((((((.(((.....))).)))))))........))))...)))))))(((((...))))).))))))....)))))))))))(((((((((.......)))..)))))))))))))))..)))))).)))))...((((...))))..))))))))..((((((((((((....))))).)))))))....((((((.(((((.((.......((((((.((((.............)))).))))))))))))).))))))))))))....))))))))))))))))))).))....)))))..))))))))))...........((((((((((((.(((.....))).)))))))((((((((..(((.((((...)))).))))))))))).))))))))))))))))))..........)))))))).))......((((((((.....))))))))(((.(((........))))))......)))))))))((((((((...........(((.((((((((...((((((((((((((...........(((((.....)))))))))))).....((((((((.((..(((..((((((((.(.((((((((...((((.((....))...)))).))))))))..(((.(((((((....((.....(((........))).....))..))))))))))..))))))))).)))..))(((.((....)).)))((((((((((.(((((((...............)).)))))...)))))))))).......(((((((((((((((((((((.(((.((((((((((......)))))...)))))((((..((((((..........(((((((........))))..)))((((((((........))).))))).(((((...)))))))))))..))))...................((((...(((((((....((((.(((....((((((((.................(((((.((.(((.(((((((.((.(((....((((((((....(((((.(((....((.((((.....((((((......))))))..((((.((((((......))...)))).)))).((.(((........)))))....(((.(((((................(.((((.((.......((....)).......)).))))).........))))))))....(((((((((((((((((...((.((((((((((((..(....)..............((((((.((((....................))))((((................)))).....((((((((((.((....((((((((..................((((.....)))).(((((......(((......)))....)))))......(.(((((((((..........(((((.............)))))))))))))).)))))))))....)).))))))))))...(((....)))...))))))...................................))))))))))))..))..))))))))))))).))))......)))).))...))).)))))......................(((((..(((((((((((((((......((((((......))))))...........(((..((......))..)))(((((((((((((((((.(((((.((.((((...(((((((((((.((((.................))))..........................((((((.((..((.((((((((((((((((.((((.....)))).)))).))....))))))....)))).))..)))))))).((((((.((...((((((((((..(((((....(((..((((.((.(((......))).)).))))..)))...)))))........(((((((((...)))))))))..((((((((((...(((((((.......(.(((((............))))).)......))))))).))).)).((((((.((........))..))))))((((.........)))).........))))).........((........((((((..(((((..................)))))..)))))).......)).(((((((.((.((..(((.....)))..)).)).)))))))((((....((((((((......))))))))..)))).........((((.((.((((((((((...((((((......((((((((.((((((..((((.((((.(((.....))).)))).....................(((((((.....((.(((((((((.((((((.....)))))))))))))))..)).....)))).)))))))..)).))))..))))))))....)))).))...)))..))))))).)).))))..)))))))))).)).)))))).....))))))))))).....(((((..(((....)))..)))))................((((((.((((...)))).)))))))))).)).)))))))))))).)))))))))))).)))).)))))))))...)))))((((((((((((....))))).))))))).))))))))....))).)).)))))))))).)).))))).......)))))))).....)))))))((..((((........))))..)).....)))))))...))))(((((..((((((((((((........))))))))))))..)))))..................(((((((....)))))))(((.(((...)))..))).))).))))).....)))).))))))))))))((((((.....))))))...)))))))))))))))...)))))))).)))..(((((((((..(((((((((((........))))))))))).(((.(((((..(((((.(.......).))))).)))))..))).....((((((((((..((((.(((.(((((...(((.....(((((........))))).)))))))))))..)))).)))...)))))))((((((((((...))))..))))))....((((((((..(((((((.((((((((...)).))))))...(((....)))..................(((....)))....((((((((........))))).))))))))))..)))))))).......((((....))))..)))))))))...............))))))))............((((((...))))))....
Thermodynamic Ensemble Prediction
.....((((((((({((((((((((((((.,,.((((.(.((.(((...))).))).)))),..))))))))...(((({....}))))))))))}..{(.((((((((,{{(((.((((((,{(({.((({.{{....}}.)))}.|,...........{{{,,{{{((.(,(((,.((({.(((..(((.((((...{..{{{.,,...}}}.........{(((.((.....)).)))}((((((.(((......))))))).)).....((((((((.......))))))})){{{{{{{.,(((((((....,,...(((((.(((.(((((.(((((((((((.{{.{(((((,,,,||}}||,,,{{{{{{||||,{{{{{.....,...,{{{{.......,))))}}},,,,.((((((((((((((.({,,.{{..,,{.{{{{......{{{{||,|..,,...,)}))))(((((((({..,(((((((((.....((...(((....(.((((((.(((((((((((((,.((((,.((((((((((...,.............{(((..||.))),...(((((....)))))....(((((((({{{({.{{{.....((((((({(....,,.})))))))...}}}.......((((((..((....))..)))))}...,{{(,,({({,{{(((,,,,...,}},,,},||||...}|.}..|......}}},,,))}}).)))..})}..((((((((.((((........)))).))))))))))}}.})))))))..(((.((....)).))).{((((((..(((.....)))..))))))).{((((((.(({.(((..........))).}}}))))))))))))))))).||},(((((((((.((((({.((((......)))).,....))))).)}...,)))))))..........,,,,,)}))))},)).))))))).)))))).).....)))...)).....)))))))))))))))))).,((((({{...{,.|||,,,..}}),})}..,))))}}).))))}}}))))))))...{{((,((((((((({,{{,,,..(((((.((((((((((((((.(((..(((((...((((....)))))))))..)))))))}}}))))......((((((((....((((.(((((.,.,....,.........,|||{{{{,(((({.{{||||}{{{,{{{.((({{(,(({({,.....,..}},..})),},}}))))))))))..,}},,,((((.(((...(((.((((.(((((..(((((.....(((((.((((.....)))).)))))...................(((....)))...,{..,{.|{,,..,}.}}..,}.))))).))))).)))).)))))).)))).,(({.,,,,|||},((..(((((((....)))))))..)),}}))))))}|}})}}},))))).)))}....))))))))((((...))))......})))..))))),,,...}}}}||,..{{{{..{{.,.,....}}))|,|}|,.))))}}))).)))),}}||({(((((((,,....,.....}},|},...}}|}},))))),}}}}},.),{|{{{{{......})))})),,.,}))))))))))).)))))))))))))...,...,),,,)))))))...})))})}..,,.))}}.)))..))).}))}))).},)))))))))(((({{.....}}.))))(((((((((((((((.....{{.{((,,(({..(((........))),{{{({,{((((..((((((({...}))))))))))))}}.......{||...,{{{{{{......,{{|||}||{|.,|{(((((((..((((..{,..((((((.((((,.(((((((.......)))))))..,,.))))))))))},))))...)))).)))||{{{{{{|||||||||||,.........,|,{{{.{{{{{,...,,,,|))))}.}},.,},,.}}}}}},,((((((((.,...{|{{{.((((((..(((.....((((((...((((((((..(((.....((((((..........(((((((..((((,.....(((((((.(((.....))).)))))))......,,))))...))))))){((({...})))}.))))))....)))))))))))(((((((({.......})}..)))))))))))))))..)))))),|||||,..,,,|}}})))}..))))))))..{(((((((((((....))))),}))))))....{(((((.{((((.{{.......((((((.((((.............)))).))))))})))))).))))))})))))}.,.}))))))}.}}|})})))).))....))))}..))))))))))...{|{{.,,,(({{{(({{{{{.{{{.....,))}))))))}((((((((..(((.(({,...)})),}}})))))))).)))}),|||||}}}}}},...,,,,})})))))))).}}......{(((((((.....)))))))|(((.(((........)))))),.....))))))))),...{(((,,......,{.(((.((((((((...((((((((((((((...........(((((.....)))))))))))).....((((((((.((..(((..((((((((.{.((((((((...((((..(,....},,.)))).))))))))..{((.(((((((....((.....(((........))).....)}..))))))))))..,)))))))).)))..))(((.{{....)),}||((((((((((.(((((((.,,.,......},,.)).)))))...)))))))))).,.,{..(((((((((((((((((((((.(((.((((((((((......)))))...)))))((((..((((((..,.,{,.{.{({((((........)))}.}}))|||||,,..{,,,,,.|||{|,,,}}}}|,|,.,)))..))))))..)))).................,,{{{{...{{{{{((....((({{(((....((((((((,,,.....,,....,,{({{{{.((,(((.(((((((,({.({(....((((((((....{{{((.{{{....,,.{(((..,,.((((((......))))))..|{({.({(({,......}}..,}))|.}}}},({((((........))}}}....(({{((({{.,.,,.,,,,..,{..{.((((.((.......((....)).......)).))))}....,,..,))))}},,..||||{,(((((((((((((...((.((((((((((((..................,,..((((((.,(((......,.............}))|((((.,.,,.........,.))))}....((((((((((.((....((((((((.,,,.......,,.....((((.....)))).(((((......(((......)))....)))))......(.(((((((((,{{{{.........{.....,}..,....))))))))))))).))))))))}....)).))))))))))...({{....}))...)))))).},......................,,........))))))))))))..))..))))))))))))).})),.,,...)))),},...))}.))))}......................(((((..((((((((((((({{......((((((......))))))......,{{..,,...,....,,,})..|}}(((((((((((((((({{(((((.((.(({{,..{((((({((({.{{{,.{,,{...,.,,,,,,|||,|||,,|,,.,.....,.,,{{((,...|||||||{{.,{{.{{{|{{{{{{{{((((.((((.....}))),)))).||.{{{|||,,||,|,|||}|||||}},|||||.,{{(({.,,...((((((({{{,{(((((..{,({(..((((.((.(((......))).)).))))..)))}..))))}........(((((((((...)))))))))..(((((({(((.,.(((((((.......(.(((((............)))))},......))))))).))).}..((((((.((........))..))))))((((.........))))........})))))..,{,....))........((((((..(((((((...,....,....))})))))..))))))..........(((((((.{{.,,..(((.....)))..}}.)).)))))))((((....((((((((......))))))))..)))).........,{,{.{{.((((((((((...((((((.....,((((((({,|(((((|.((({,{{((,({,.....|||,}|||........}}}.....,..,,|||{(((,.{{,{{.{{{{{{|||,|{||{{....,|||||}||||||}}}..}}}}},.))))})},}))),.}).)))),.}}))))))....)))).))...)))..})))))).)).,}}},})))))))))),})|)))},}....,)))))}}}}||{,,,.(((((..(((....)))..))))}.,,,..,}}}}}},.,{{{|||,||||,,.)))),))}})))))).)).)))))))))))).))))))))))}).))))))))))))))...))))){((((({(((((....))))).}))))}}.)))))))).,..))).}}.)))))))))).)).})}}}...,,..)))))))).....)))))))||,,|{{{........)))).,)}...,.})))))).,,,}}}(((((..((((((((((((........))))))))))))..))))).,.,.,,......,,.,.{((((((....))))))|(({.{{,..,},),,},..))).))))),....})))}}))))))))))){{||((,,,..}}}}))}},)))))))))))))))...)))))))).))),,(((((((((,,(((((((((((........))))))))))).||..{,,{,....,,{((((,{,,.,..}}})})}}}}},))},.,..{(((((((((..((((.{((.(((((...{(((....,|||(,,......}))))..,,)))))}))..)))).)))...))))))|((((((((((...))))..)))))),...{(((((((..(((((({.,{{{{||,...||,||}|}|.{{((,....)))}.}}....,,,,}}....,,,.,,.,}}....((((((((........))))).))).})))))..)))))))}.,.....((({....})))..)))))))))..............,||||||||{{......}}}}||||||...,,,,))}},.

Transcripts

ID Sequence Length GC content
AACCGACGCGCGUCUGUGGAGAAGCGGCUUGGUCGGGGGUGGUCUCGUG… 5695 nt 0.3893
Summary

This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010] CIViC Summary for TOP2A Gene

Forensic Context

A study in humans identified the TOP2A as a key dysfunctional gene whose expression was significantly correlated with survival in severe burn patients and was a risk factor for death in single-factor Cox regression analysis [Liang et al. DOI:10.21037/atm-22-3918]. In human epidermal keratinocytes, the TOP2A was downregulated (0.62-fold) 3 hours after exposure to 5 Gy of X-ray irradiation [Koike et al. DOI:10.1269/jrr.46.173].