| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGGGGCCCAGCGGCCCGCAGGGAGGCGGGAGCGGCGGCUGCGGCCUCA… | 5360 nt | 0.3862 | |
| GUGUGUGCGGUGUUAUGCCGGACAAGAGGGAGGUGACCGUGGCGGCGGC… | 5814 nt | 0.4202 |
This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
A study in mice demonstrated that the mRNA of the TOP2B was down-regulated (0.39-fold) in bone marrow cells 6 hours after a whole-body 6.5 Gy ionizing radiation dose [Dai et al. DOI:10.1080/09553000600857389].