| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCUUCUUAAACAAACCACAAACGGAUGUGAGGGAAGGAAGGUGUU… | 4076 nt | 0.4105 |
The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.[provided by RefSeq, Apr 2009] CIViC Summary for TOX Gene
A study in human traumatic brain injury (TBI) patients demonstrated that the mRNA for TOX (thymocyte selection associated high mobility group box) was part of a negatively correlated lncRNA-mRNA pair in a co-expression network constructed from differentially expressed transcripts in brain contusion tissue [Yang et al. DOI:10.4103/1673-5374.247467]. In a separate investigation of postmortem transcriptome dynamics in zebrafish, the TOX transcript abundance increased after 12 hours postmortem, reaching a maximum at 24 hours [Pozhitkov et al. DOI:10.1098/rsob.160267].