| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCGUGAGGGGUUUGUAAUGCAGGGCUGAGGAGUGUCCGAAGAGAAUG… | 2525 nt | 0.5279 | |
| CUCAAAAGUCUAGAGCCACCGUCCAGGGAGCAGGUAGCUGCUGGGCUCC… | 2642 nt | 0.5250 | |
| CUCAAAAGUCUAGAGCCACCGUCCAGGGAGCAGGUAGCUGCUGGGCUCC… | 2642 nt | 0.5250 | |
| AUUCGUGAGGGGUUUGUAAUGCAGGGCUGAGGAGUGUCCGAAGAGAAUG… | 2658 nt | 0.5196 | |
| AUUCGUGAGGGGUUUGUAAUGCAGGGCUGAGGAGUGUCCGAAGAGAAUG… | 2658 nt | 0.5196 |
This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016] CIViC Summary for TP53 Gene TP53 mutations are universal across cancer types. The loss of a tumor suppressor is most often through large deleterious events, such as frameshift mutations, or premature stop codons. In TP53 however, many of the observed mutations in cancer are found to be single nucleotide missense variants. These variants are broadly distributed throughout the gene, but with the majority localizing in the DNA binding domain. There is no single hotspot in the DNA binding domain, but a majority of mutations occur in amino acid positions 175, 245, 248, 273, and 282 (NM_000546) (Olivier et al., 2010). To fulfill its proper biological function four TP53 polypeptides must form a tetramer which functions as a transcription factor, therefore even if one out of four polypeptides has inactivating mutation it may lead to dominant negative phenotype of variable degree. While a large proportion of cancer genomics research is focused on somatic variants, TP53 is also of note in the germline. Germline TP53 mutations are the hallmark of Li-Fraumeni syndrome, and many (both germline and somatic) variants have been found to have a prognostic impact on patient outcomes. The significance of many polymorphisms for susceptibility and prognosis of disease is still very much up for debate.
A study in mice demonstrated that the postmortem expression of the TP53 in liver tissue increased from 3 to 6 hours and then decreased from 9 to 24 hours after death, with a cubic mathematical model established for postmortem interval estimation achieving a coefficient of determination (R²) of 0.718 [Noshy DOI:10.1007/S00414-020-02419-5]. A systematic review further noted that the TP53 is involved in apoptosis processes and was mentioned in the context of postmortem studies [Cianci et al. DOI:10.3390/ijms25158185].