| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACACGAAGCCUCCCGGGUGGCUUACAGACGCUGCCAGCAUCGCCGCC… | 951 nt | 0.5594 |
The protein encoded by this gene shares a critical BH3 domain with other death-promoting proteins, such as BID, BAK, BAD and BAX, that is required for its pro-apoptotic activity, and for interaction with anti-apoptotic members of the BCL2 family, and viral survival-promoting proteins. Since the activity of this protein is suppressed in the presence of survival-promoting proteins, it is suggested as a likely target for anti-apoptotic proteins. [provided by RefSeq, Sep 2011]
A study in human cadavers demonstrated that the BIK was down-regulated (-69.1186 fold) in decaying liver tissues compared to a control, as part of the apoptotic thanatotranscriptome where mRNA was stable for analysis up to 48 hours postmortem [Javan et al. DOI:10.1007/S12024-015-9704-6]. A study in zebrafish demonstrated that the BIK transcript, a pro-apoptotic protein, showed increased abundance after 1 hour postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].