Basic Information

Symbol
BIK
RNA class
mRNA
Alias
BCL2 Interacting Killer NBK BCL2-Interacting Killer (Apoptosis-Inducing) Bcl-2-Interacting Killer Apoptosis Inducer NBK Natural Born Killer BIP1 BP4 Apoptosis-Inducing NBK
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001197.5
Sequence length
951.0 nt
GC content
0.5594

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-378.50 kcal/mol
Thermodynamic ensemble
Free energy: -393.42 kcal/mol
Frequency: 0.0000
Diversity: 239.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((((..((((((........)))))).(((((((.((((((...(((((...((((......))))...)))))(((....)))....((((...)))).((.(.((((((.(((((((((.((......)).)))))((.(((.(((..((((.....(((((((((.(((((((......(((((....))))).(((((((.((.(((.(.(((...(((((((.((((.((.(.((((........)))).).)).)))).)))))))..))))))).))((.(((...))).)).)))))))...(((.(((((((...((......))))))))).))).))).))))((((((((..((((....((((....))))....))))...)))))))).....(((((.((.....)).))))))))))))))))))))).))).)))))).)))))).).))(((((..((.((.(((((....)).))))).)).)))))(((((((.(((.((.....)).)))))))))))))))).((((((((((((((........))).).)).))))))))(((((((((((.....)))))))))))....((((((((.....((((........))))........))))))))(((((((.....(((((........)))))...................))))))).(((((((((....)))))))))(((((..(((...(((...(((((.(.....).))))).)))))).))))).(((.((((.(((((((.((((((.....))))))..)))))))))))))).(((((((....)))))))..)))))))((((((.....((((((......))))))))))))....)))).)))........((((((...))))))
Thermodynamic Ensemble Prediction
......,,{((((({.,((((((.....,..|}}|}|((((..(((((((((,.{((((,...((((......))))...|||||({{{....})}..}|}}}}..))))}.}...((((((.(((((((((.((......)).))))){(.(((.(((..((((.....(((((((((.,((({,{,|||..{{{,{,,|,}}})}.{((((((.((.(((.(.(((...(((((((.((((.((.(.((((........)))).).)).)))).)))))))..))))))).))((.(((...))).)).))))))}..,(((.(((((((...,,......)}))))))).))).},{{|,,}(({((({{.,(({(,,,,({{,..,.||},,,..}}}}..,)}))))}}..,},(((((.((.....)).))))))))))))))))))))).))).)})))).)))))){|{(({({.{{.,,.||.|}}}},{{{|{{|||||{,,.,)))}|((((((.(((.((.....)).)))))))))))))))){((((((((((((((........))).).)).))))))))}.))))))))).})))}|.||{{......}}}},||..,,.,..||.,......,,,....,,,,,..)}}}||||(((((({,,..|(((({||||,,,,|||}}||,{{,||.......,{{{{||||||.(((((((((....)))))))))..,..,{((((({,{,...(,(((.({{{,.,.,))))}.)))},.}},.))))))||((.(((((((.((((((.....))))))..)))))))))}}||,.(((((((....)))))))..}}..((((,,,||},...,{{{{|}}}}}})))),,})))))})),}))),)}},..,,,,,|{||||,,,)))))}

Transcripts

ID Sequence Length GC content
AGACACGAAGCCUCCCGGGUGGCUUACAGACGCUGCCAGCAUCGCCGCC… 951 nt 0.5594
Summary

The protein encoded by this gene shares a critical BH3 domain with other death-promoting proteins, such as BID, BAK, BAD and BAX, that is required for its pro-apoptotic activity, and for interaction with anti-apoptotic members of the BCL2 family, and viral survival-promoting proteins. Since the activity of this protein is suppressed in the presence of survival-promoting proteins, it is suggested as a likely target for anti-apoptotic proteins. [provided by RefSeq, Sep 2011]

Forensic Context

A study in human cadavers demonstrated that the BIK was down-regulated (-69.1186 fold) in decaying liver tissues compared to a control, as part of the apoptotic thanatotranscriptome where mRNA was stable for analysis up to 48 hours postmortem [Javan et al. DOI:10.1007/S12024-015-9704-6]. A study in zebrafish demonstrated that the BIK transcript, a pro-apoptotic protein, showed increased abundance after 1 hour postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].