| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUGAAGCUGGGCGCCUUCGGGGCUUGAGCUUCUGAGGGUCGGGUCC… | 4969 nt | 0.5569 |
This gene encodes a putative cation-selective ion channel with two repeats of a six-transmembrane-domain. The protein localizes to lysosomal membranes and enables nicotinic acid adenine dinucleotide phosphate (NAADP) -induced calcium ion release from lysosome-related stores. This ubiquitously expressed gene has elevated expression in liver and kidney. Two common nonsynonymous SNPs in this gene strongly associate with blond versus brown hair pigmentation.[provided by RefSeq, Dec 2009]
A study in mice demonstrated that the TPCN2 was significantly upregulated (2.28-fold) in injured dorsal root ganglia following spinal nerve ligation, as identified through strand-specific RNA sequencing and validated by quantitative real-time PCR [Wu et al. DOI:10.1177/1744806916629048].