Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACCCAGCCUGCACCUACUGGCGCCCGAGUUUUAGAGAAUUACUCCAAA… | 4826 nt | 0.3786 |
Summary
This gene encodes a member of the aromatic amino acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene have been associated with an elevated risk for a variety of diseases and disorders, including schizophrenia, somatic anxiety, anger-related traits, bipolar disorder, suicidal behavior, addictions, and others.[provided by RefSeq, Apr 2009]
Forensic Context
A study in humans demonstrated that the A allele of the TPH1 A218C polymorphism was significantly more frequent in suicide attempters (46.33%) than in healthy controls (35.71%) within a Turkish population, suggesting an association with suicidal behavior [Beden et al. DOI:10.1016/J.Legalmed.2016.05.005]. Research in mice and human tissues further established that the TPH1 is expressed in the developing pancreas and, along with serotonin signaling components, is part of a regulatory network whose prenatal disruption by psychostimulants leads to lifelong impairment of insulin production and glucose homeostasis, particularly in female offspring [Korchynska et al. DOI:10.15252/embj.2018100882].