Basic Information

Symbol
TPH1
RNA class
mRNA
Alias
Tryptophan Hydroxylase 1 TPRH Tryptophan Hydroxylase (Tryptophan 5-Monooxygenase) Tryptophan 5-Monooxygenase 1 Tryptophan 5-Hydroxylase 1 EC 1.14.16.4 TRPH TPH Indoleacetic Acid-5-Hydroxylase Tryptophan 5-Monooxygenase L-Tryptophan Hydroxylase EC 1.14.16
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Drug abuse diagnoses

MANE select

Transcript ID
NM_004179.3
Sequence length
4826.0 nt
GC content
0.3786

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1218.20 kcal/mol
Thermodynamic ensemble
Free energy: -1318.01 kcal/mol
Frequency: 0.0000
Diversity: 1068.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((.((....)).))..........((((((..((((((.(((((((....)).......(((((((((...((((..((((((.....))))))......))))....)))))))))....))))).)))))).............(((((((...))))))).......(((((((((((((((((...((((.((((((((..(((..............)))..))))))))..))))(.(((.(((.(((((((.(((........))).))).)))).))).))).)((((((.(.((((.((.(((((.............)))))...)).)))).)))))))((((((((.....))))))))...(((((((...((((((((((((.(((((((((.(((((.(((......))).)))))...(((.((((.....(((.(((..(((((((((..(((((((...(....)...))))))).((((((((((.........)))))..((..(((((((((((((((.((((((((((((((((.((((.((.((....))(((..(((((.((((..((((((((((.............((((((.(((...........)))))))))(((..(((..(((.(((((((((((........))))..........))))))).)))..)))..))).(((.((((((.............)))))))))(((.....))).((((((((.........((((((((((......((.((((((............)))))).)).((..(((.....)))..))...(((((..((((...(((.(((....))))))..))))..))))).))))))))))((((..(((...((((....))))...)))..)))))))))))).(((((....))))).....(((((.(((((...))))).)))))....))))))))))((((((.(.....).))))))......)))).)))))))).)))))).)))))))).)))))))).)))).((((..(.....)..)))).(((((.......))))).....(((((..((((....))))...)))))........((((((.....(((.((((((((((...........)))))))))).)))...)))))).......................)).)))))))))..))....(((........)))((.(((((...)))))..)).))))).((((.....))))((((..((.....)).)))).....)))))))))..))).)))........)))).)))(((((((((.(..(((((((((((((((............((((((((((..((.((((((((((((((.....((((.(((((.....((.......))))))).)))).....)))))...............(((((.........))))).(((((((((((((.........(((..(.((((((((...((((.((((((((((((.((((((((..((((((((((((((((((((((..((.(((((((......((((....(((...((((((..((((((.....))))))(((((((.....((((....))))....((((((..((((((((((((......(((.((((((........((((((((...((((((((((..((((.(((........)))..))))..)))))..)))))..........))))))))...((((((.(((.((.((((((((.((...)).)))....))))))).)))....)))))).((((..((((..((((.(((((((((((.(((((.((......)).))))).))))........)))))))))))..))))))))(((((((((.(((((..(((...(((((..(((.((..(((((((((((((((((((((..(((.((.((.....)).)).)))....))))..))))....))))))))).))))...)))))))))))))..)))))....))))))))).((((..........))))......((((.((((((......))))))..)))).)))))).))).....))))))....))))))((((.....)))).))))))...))))))).))))))...)))......)))))))))))..)).........)))))..)))))))))))))))))...))).))))))))))))))))).....))))...)))))))).)..)))((((((((((((((....))))))))..(((((((((.................(((.(((((((((((.((((((...((((((((((..............((((..(((......)))..))))(((((.((((((..((((......((((.....))))..((((((((......)))))))).....(((((.(((...((((((...))))))....)))..)))))....)))).))))))))))).............)))))))))).(((..(((...((((((...)))))))))..)))..))))))))))))))))).)))((((((((....(((((..((((..((((.....(((....))).....))))..)))))))))....((((((.........(((((((((((((((((............)))).))).))).....)))))))((((.((....)))))).....(((.....((((.((..(((((((((......)))))).))))).))))((((((((......)))))))).)))......((((((..(((.((((.((((((.(((.((((......))))........((((((((.......((.(((((..((((((..(((....)))...)))))).((((...((((((....(((((((((.(((.(((..((((....))))......................(((.(((((((.((((((((((((((.....(((((..(((............))))))))....)))))))..........((((((((.............))))))))...........((((......)))).((((((..((((...(((...))).)))).))))))......(((....)))))))))).))))))).)))...))).))))))))))))....))))))...))))((((((..((((.(((((.(((((.(........)))))).))))).)))))))))).................((((((((((((((..((((((((.................((((((((((((..(((((((.....((((((.......))).)))........(((((((((((((((....(((((.....(((((..((.(((..(((((.........)))))..))).))....))))).......)))))...))))))))))..(((((((((...))))).)))))))))..((((......)))))))))))..))))))))))))))))))))..)))))))))))))).((((((((...)))))))).....((((((.(((((((((((.((.((((........)))).)))))).....((((((((.(........((((.(((((((((((.(((((((......(((....)))......))))))).............)))))..)))))))))).((((.(((((((...((((.......)))).))))))).))))...(((......))).(((((......))))).....).)))))))))))))))))))))....))))).)).......))))))))(((((((((((((((...((((((.((((.............(((((...))))).....(((((((........)))))))((((((.(((...........))).))))))..)))).))))))...))))))..)))))))))........))).)))))))))).))).....))))))(((((((...)))))))..((((((.((.((((.(((((........))))))))).)).))))))))))))((((((......))))))..(((((...........)))))))))))))))))))))).((((((((.((((((..(((......)))(((.(((((.......))))))))..(((((......)))))......(((((......)))))))))))))))))))........))))))........))))))))).)))).........)).))))))).)).)))))))))).))))))...(((((((..((.((......)).))..)))))))...(((((.(((((((.....)).)))))...)))))...........)))))))))......).)))))))))...(((......))).....(((((((((.........((((((((........)))))))))))))..))))..))))...))))).))))))))....)))).))))))).......))))))))).........)))))))).(((((((((((....)))))))))))...............))))))..
Thermodynamic Ensemble Prediction
({....,,..({.{{....)).)}..(((({{..(((.....))).}))))).{{{....||{((((((..(..(((.((((((((((,((((...,))))(((((.(,.{{.{((((((({....})))))))|(((((((({,(..........(((((({...}))))))..(((((((.{.....(((.(((((((((((((((((..,......{((((.((((,...,)))).)))))(({{(,.,,,,{,|}}}|((((((({,(((.((((.{{{(({{,.....,))))}.))))..))))))))))}|||||,...{,|.|||{.......((((((((..,((((((.(((((((((.....)))))))))....(((.(((((...(((((....)}.))).))))).)))..,...((.(((({...})))).)).)))))).,..))))))))...,})))}...}}..,,,,},...}..))))).)))))))).)))))))........((((({{....((((..(((((.((((..((....))..))))..)))))..))))..}}.)))))((((.........)))).......,)))))))((((((.(((...........))))))))){(((((,..{(((((((((({.....}}}.,}})})))))))))))))..}))))))))),.....{(((((......))))))......,(((((((((((((((((.....,{((((({...,.....((((((((((......((.((((((............)))))).}).{{..(((.....)))..}}...{((((..((((.,{({(.{{,....,}}))),,))))..))))}.)))))))))),{{,..{,((((((((....))))}))))|,,|||||||}||||,{((({..,,|}|||,(((((...(((((....(((((.(({.(((((((((((......))))}.....{.((((((((.(((((..((.(((((((..((((((((((..{{,...{{{{,.......,,{|,,|}...})},,,,}..)))))}}})))...(((({..,,|||},((((....))))..,,||||{{{|{{.{((,,,|}}.}}{({.((((((((((..,.....,..)))))))))).})).))))))),,...)))))))))..)),})))))))))),.)))))}(((((.....)))))..((.((.(((((...)))))..)).))})))))))..)))))....))))),.((((((((((.......)))))).)))),,{||||||{||,,,,,,))}}))}}}}})})},,,....))))))))))))..))))).}.((((((((((..{,.((((((((((((((.....((((,(((((..............,)))))).)))).....))))).............{.{((((.........)))))}(((((((((((((...,{((({(((,,,.{{{((((({.,(((..(((((((((((,.((((({({,,(((((((((((((((({(((({.,((.{{{{{{{......{|||..,,||{.,,{{||{{...{((({....,)))}}|(((((({.....|{||,..,|||},|||((({{{.,(((({{{(((((..{((((((.((.(((({..,..,{,,,,(((({.,{{{{(((((..((((.(((........)))..))))..)))))..}}}})))))...........|||{{,{,,,||}||..((.((({{{((,((...}}.}}}..,,}}}}},,.........,,((((.,..}}}}.,||{{|||{{(((.||...}))}},}}}}))))))}.))))).)).))))))}{{((({,,.,{{{{,{{{,{{{{(((((((((.(((((..(((,..(((((..(((.,(..(((((((((((((((((((((..(((.{{.((.....)).}}.)))....))))}.,})),...,)))))))).))))...,))))))))))))..))))}....))))))))}.|||,.......,,.|},|,{,,..,,|||||||{||...,||||||,..,.,,.,,,....))))}},.)))))),..}))))}){(((,...,)))),}))}}}...})))})).)))))),,,))).,....,||||}}}}}}}}}}.,.,,,,,,}})))..))))))))))))))))),,.,,,,))))))))))))))))),....})))},,)))))))),},.,))||{||||||{{{{|..,,)))))))),,(((((((((.....,......,...{(((.(((((((((((.((((((...((((((((({..,...,,{..,..{{{(..{{{,,..,,|}}..}}},(((((.((((((..((((..{{..((((.....)))).,}|,||||{......|||||,,.}}}}}(((((.(((...((((({...})))))....)))..)))))....}}}}.)))))))))))........},,..)))))))))).{((..(((...((((((...)))))))))..))}..))))))))))))))))).)))|(((((((...,(((((..((((..((((.....(((....))).....))))..)))))))))....((((((.........(((((((((((((((((............))))},)).))).....))))))){{{{{{{,,{,||,,,.....}|||...,||{{{.,,..{((((((((......)))))).))}}}.,,,|((((((((,.....))))))))|{{...})},((((((..(((.{((,.((((((.(((,((({......}})}.......,((((((((......,((,({(((..{(((((.,(((....})).,.)))))}.,{{(,,.((((((....((((((({{{(((.(((..{{{{....,}}}.....................,{|{.(((((((.((((((({((((({.....(((((,.(((............))))))))....}))))}}.,,,,...,.,,(({((({{,.{{,......}}))},,)}}}}},}},,,|{{{......))),.((((({..{({,...{{{...)}}.}))),))))))......,,,....})}))))))).))))))).}}},..))).))))))))))))....)))))),,,||}|((((((..((((.(((((.(((({,(........)))))).))))).))))))))))}},..............,(((((((((((((..((((((((.................{(((((((((((..(((({((((.{.(((.{{........}).))).}.)))).(((((((((((((((....(((((,{,..(((((..,{,(((..{((((.........}}})),,))},}}....)))))...,...)))))...))))))))))..{{{{(((((...))))).}}},)))))..((((......)))),})))))}})))))))))))))))))))),})))))))))))))}.((((((((...)))))))).....((((((.(((((((((((.((.((((.,.....,)))).)))))).....((((((((,(.......,|{((.(((((((((((,(((((((,,....(((....))).....,))))))).,,...........})))..))))))}))}.((((.(((((((...((((,......)))).))))))).))))...(((......)}}.(((((......))))).....),)))))))))))))))))))))....}))))})).......))))))))|((((((((((((((.,.((((((.((((......,,,....(((((...))))}...,||{{({{{......,.||}}},,.{{{{(|{,{{...,,...,,})))}))))),.)))).)))))).,.))))))..)))))))),......,.))).)))))),,,,,,},},,..))))))(((((((...)))))))..((((((.((.((((.(((((........))))))))).)).))))))))))))((((((......))))))..(((((...........))))))))))))}))))))))).((((((((.((((((..,,,.......},(((.(((((.......))))))))..(((((......)))))......(((((......)))))))))))))))))))........,,,,,,........))))))))).)))).........)).))))))).},.)))))))))).}})).))))),,..((((((((((((((.,,..(((((((((((((({(((.(((((((.....)),}))))...}},,..||,.......,,||({{((((....,,}}))),.,}}}.{((......))}.....((((...........)))).,,.}))))))),...})))))........)))))))))...)))))..))))))}...))).}))..)..))))))}.,,.((((({{((....))))..))))).{((((((((((....))))))))))}(((((.......,.)))))))..

Transcripts

ID Sequence Length GC content
GACCCAGCCUGCACCUACUGGCGCCCGAGUUUUAGAGAAUUACUCCAAA… 4826 nt 0.3786
Summary

This gene encodes a member of the aromatic amino acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene have been associated with an elevated risk for a variety of diseases and disorders, including schizophrenia, somatic anxiety, anger-related traits, bipolar disorder, suicidal behavior, addictions, and others.[provided by RefSeq, Apr 2009]

Forensic Context

A study in humans demonstrated that the A allele of the TPH1 A218C polymorphism was significantly more frequent in suicide attempters (46.33%) than in healthy controls (35.71%) within a Turkish population, suggesting an association with suicidal behavior [Beden et al. DOI:10.1016/J.Legalmed.2016.05.005]. Research in mice and human tissues further established that the TPH1 is expressed in the developing pancreas and, along with serotonin signaling components, is part of a regulatory network whose prenatal disruption by psychostimulants leads to lifelong impairment of insulin production and glucose homeostasis, particularly in female offspring [Korchynska et al. DOI:10.15252/embj.2018100882].