Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAUUGCUCUUCAGCACCAGGGUUCUGGACAGCGCCCCAAGCAGGCAGC… | 2360 nt | 0.4305 |
Summary
This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
Forensic Context
A study in mice demonstrated that prenatal psychostimulant exposure permanently impairs pancreatic beta cell insulin production via serotonin signaling, specifically implicating the TPH2 expressed in these cells and linking its epigenetic regulation to glucose intolerance in adult female offspring [Korchynska et al. DOI:10.15252/embj.2018100882]. In humans, a genetic association study in a Turkish population found that the A allele of the TPH1 A218C polymorphism was significantly more frequent in suicide attempters, with sex-specific genotype associations observed in males [Beden et al. DOI:10.1016/J.Legalmed.2016.05.005].