| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGAUCCGCGGAAGGGCAGAAUGGGACUCCAAGCCUGCCUCCUAGGG… | 3492 nt | 0.5049 |
This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.